Skip to main content

Full text of "Journal of the Kentucky Academy of Science"

See other formats


till 

.K4 

T7 

v. 65 
no. 2 
Fal 2004 



JOURNAL 



KENTUCKY 

ACADEMY OF 

SCIENCE 



Official Publication of the Academy 




Volume 65 
Number 2 
Fall 2004 



The Kentucky Academy of Science 

Founded S May 1914 



Governing Bourn 2004 

Executive Committee 

2004 

President: Robert W. Kingsolver, Kentucky Wcslcvan CoUege/kingsoI@kwc.cdu 

President Elect: Bruce Mattingly, Morehead State University/b. mattin@morehead-st.edu 

Vice President: Miriam Sleinitz-Kannan, Northern Kentucky Universily/kannan@nku.cdu 

Past President: Robert J. Barney, Kentucky State University/rbamey@kysu.edu 

Secretary: Dawn Anderson, Berea College/dawn-anderson@berea.edu 

Treasurer: Kenneth Crawford, Western Kentucky University/kenneth. crawford@wku.edu 

Executive Secretary (ex officio): Donald Frazier, University of Kentucky/dfrazie@pop. uky.edu 

Editor, JOURNAL (ex officio): John VV. Thieret, Northern Kentucky' Universitv/thieretj@exchange. nku.edu 

DmSIOX AND AT-LARCE REPRESENTATIVES 

Physical Sciences (2004): Jennifer Muzyka, Centre ColIege/muzyka@centre.edu 

Biological Sciences (2005): Thomas Rambo, Northern Kentucky Universitv/rambot@nku.edu 

At-Large (2005): Ralph Thompson, Berea College/ralph_thompson@berea.edu 

Social Sciences (2006): Darid Hogan, Northern Kentucky University/hogan@nku.edu 

Physical Sciences (2006): Mark Blankenbuehler, Morehead State University/blanken@morehead-st.edu 

Program Coordinator (ex officio): Robert O. Creek, Eastern Kentucky University/rcreek@chpl.net 

Director, Junior Academy of Science (ex officio): Elizabeth K. Sutton, Campbellsville University/ 

eksutton@campbeIls\Tlle.edu 
Editor, NEWSLETTER (ex officio): Susan Templeton, Kentucky State University/ 

templeton@gwmail.kvsu.edu 
Editor, KAS Webpage (ex officio): Claire Rinehart, Western Kentucky University/claire.rinehart@wku.edu 
AAAS/NA4S Representative (ex officio): Guenter Schuster, Eastern Kentucky University/ 

guenter.schustei-@eku.edu 

Committee on Publications 

Editor and Chair: John W. Thieret, Northern Kentucky University/thieretj@exchange.nku.edu 

Abstract Editor: Robert J. Barney, Kentucky State Universitv/rbarney@gvvmail.kysu.edu 

Index Editor: Varlev E. Wiedeman/varIeyw@mac.coni 

Editorial Board: Ralph Thompson, Rerea CoIlege/ralpli_thompson@berea.edu 

Susan Templeton, Kentucky State University/stempleton@gwmail.kysu.edu 
Claire Rinehart, Western Kentucky Universih7claire.iTnehart@wku.edu 

All manuscripts and correspondence concerning manuscripts should be addressed to the Editor. 

The JOURNAL is indexed in BIOSIS, Cambridge Scientific Abstracts. Selected Water Resource Abstracts, State 
Academies of Science Abstracts, and Zoological Record. 

Membership in the Academy is open to interested persons upon nomination, payment of dues, and election. Application 
forms for membership may be obtained from the Secretary. The JOURNAL is sent free to all members in good standing. 

Annual dues are $25.00 for Active Members; $15.00 for Student Members; $35.00 for Family; $350.00 for Life Mem- 
bers. Subscription rates for nonmembers are: $50.00 domestic; $60.00 foreign. Back issues are $30.00 per volume. 

The JOURNAL is issued semiannually in spring and fall. Two numbers comprise a volume. 

Correspondence concerning memberships or subscriptions should be addressed to the Executive Secretary. 

® This paper meets the requirements of ANSI/NIS0 Z39.48-992 (Permanence of Paper). 



INSTITUTIONAL AFFILIATES 

Fellow 

University of Kentucky 
University of Louisville 

Sustaining Member 

Campbells ville University Kentucky State University 

Morehead State University Murray State University 

Northern Kentucky University Western Kentucky University 

Member 

Asbury College Bellarmine University 

Berea College Centre College 

Cumberland College Eastern Kentucky Univerity 

Kentucky Wesleyan College Madisonville Community College 

West Kentucky Community & Technical College 

Associate Member 

Pikeville College 
Transylvania University 

INDUSTRIAL AFFILIATES 

Associate Patron 
Touchstone Energy 

Associate Member 

Hoffman Environmental Research Institute 

Third Rock Consultants 

Wood Hudson Cancer Research Lab 




Figure 1. Fatoua villosa. a. Whole plant, b. Inflorescence, c. Staminate flower, d. Staminate 
flower, long section, e. Floral diagram of staminate flower, f. Pistillate flower, g. Pistillate flower, 
long section, h. Floral diagram of pistillate flower, i. Fruit, j. Seed. Bar = 1.5 cm for a; 0.5 
mm for b; 1 mm for c, d, f, g-j: Drawings by Priscilla Fawcett; taken from Correll and Correll 
1982; used by permission of the publisher. 



JOURNAL OF THE KENTUCKY ACADEMY OF SCIENCE 

ISSN 1098-7096 



Continuation of 
Transactions of the Kentucky Academy of Science 



Volume 65 



Fall 2004 



Number 2 



J. Ky. Acad. Sci. 65(2):67-75. 20(14. 

Spread of Fatoua villosa (Mulberry Weed; Moraceae) 
in North America 

Michael A. Vincent 

W. S. Turrell Herbarium (MU), Department of Botany, Miami University, Oxford, Ohio 4.5056 

ABSTRACT 
Fatoua villosa (mulberry weed, Moraceae) is documented from 28 states and die District of Columbia in 
die United States. The species has spread through the horticultural trade to greenhouses and nurseries, from 
which it has escaped into gardens, lawns, and ruderal areas. A small percentage of the collections examined 
were from more natural settings in open forested sites or along streams. The species is illustrated and 
described, and maps are provided showing its spread in the 50 years since it was first collected in this 
country. First reports are provided for mulberry weed in die District of Columbia, Illinois, Minnesota, 
Oregon, Pennsylvania, and Wisconsin. 



INTRODUCTION 

Forty years ago, Thieret ( 1964) reported the 
discovery of a new weedy plant species for 
North America, Fatoua villosa (Thunb.) Na- 
kai, commonly called "mulberry weed," "hairy 
crabweed," or "kuwa-kusa," a member of the 
Moraceae (mulberry family). Thieret cited in- 
formation provided by Dr. Joseph Ewan, of 
New Orleans, that the species had been 
known in diat city for about 15 years. Since 
that time, the species has spread across North 
America, and literature reports exist for its 
presence in 26 states in the United States. 

The genus Fatoua was described by Gau- 
dichaud (Freycinet 1830). Two or three spe- 
cies of the genus are native to Australasia 
(Chew 19S9; Hutchinson 1967; Rohwer and 
Berg 1993; Zhou and Gilbert 2003) and an ad- 
ditional species is found in Madagascar (Berg 
1977; Leandri 1948). Fatoua villosa (Figure 1) 
was first described by Thunberg (1784) as Ur- 
tica villosa (Urticaceae); the epithet was trans- 
ferred to the genus Fatoua by Nakai (1927). 
Synonyms include Urtica japonica Thunberg 
(1784), Fatoua japonica Blume (1856), and 



Boehmeriopsis pallida Komarov (1901). Mi- 
quel (1869) published the only monograph of 
the genus to date, treating it as a member of 
the Urticaceae. The first treatment of Fatoua 
as a member of Moraceae was by Gaudichaud 
(Freycinet 1830), who described two addition- 
al possible synonyms, F. pilosa and F. aspera. 
Placement of the genus in Moraceae is sup- 
ported by Yamazaki (1982), who showed that 
seed development patterns in Fatoua follow 
those found in other Moraceae and is unlike 
that of Urticaceae. 

Mulberry weed is native to China (Li 1986), 
[apan (Ohwi 1965), Korea (Komarov 1901; 
Lee 1989), Okinawa (Walker 1976), Ryukyu 
Islands (Walker 1976), Taiwan (Liu and Liao 
1976), and Tonkin (Reed 1977). In addition to 
reports from the continental United States, 
which will be discussed below, mulberry weed 
has been reported as an introduced weed in 
the Bahamas (Correll and Correll 1984), Cor- 
sica (Jeanmonod 2000), Finland (Kuitunen 
and Lahtonen 1994). Hawaii (Yatskievych and 
Raveill 2001), and Puerto Rico (Liogier 1997; 
Liogier and Martorell 2000). In its native 
range, mulberry weed is considered weedy in 



fi,S 



[ournal of the Kentuck) Academ) of Science 65(2) 



cultivated or grassy fields, along roadsides, on 
trailsides, in open woods, and in rocky areas 
(Holm et al. 1979; Ohwi 1965; Randall 2002; 
Walker 1976; Zhou and Gilbert 2003). As an 
introduced weed, it has been found in green- 
houses, nurseries, flowerbeds, potted plants, 
and botanical gardens; a few records are from 
woodlands, riverbeds, and forest edges and 
fencerows. 

Fat ou a villosa is an herbaceous, erect, tap- 
rooted annual with colorless sap without latex. 
Stems of the species are 10-90 cm in height, 
may be simple to much branched, and range 
in color from green to maroon red; they are 
thinly to densely short hairy. In general aspect, 
die species greatly resembles taxa of Urtica- 
ceae and, indeed, when first encountered is 
often mistakenly identified as a member of 
that family. Its leaves are alternate, thinly sca- 
brous, broadly ovate to lanceolate, 3-10 X 1- 
5 cm, tootiied, cordate to truncate at the base, 
acute to acuminate at the apex; petioles range 
from 0.5-6 cm; stipules are small, free, and 
early-deciduous; venation in the leaves is pal- 
mate to pinnate. Punctate cystolitiis, com- 
posed of calcium carbonate, are present in die 
leaves. Inflorescences are axillary, condensed 
cymes that are often nearly capitate, 4—7 mm 
wide, on peduncles that vary from very short 
to 2-3 cm in length; each inflorescence is sub- 
tended bv a small bract. Plants are monoe- 
cious, with staminate and pistillate flowers in 
each inflorescence; inflorescences lower on 
the stem contain predominately pistillate flow- 
ers; die further up the stem the inflorescence 
is positioned, the larger the percentage of sta- 
minate flowers. Among the fertile pistillate 
flowers can be found staminate flowers with 
morphologically distinct pistils (pistillodes) 
without ovules. The calyx is 4-lobed, pubes- 
cent, yellowish in staminate flowers, and green 
in pistillate flowers; die corolla is absent. 
Functional pistils are bicarpellate and uniloc- 
ular; the style is lateral and appears un- 
branched, but has a very small aborted stvle 
branch positioned at die base of the larger 
functional style; there is a single pendulous 
ovule. Staminate flowers contain four exserted 
stamens positioned alternately widi the calyx 
lobes. Fruits are achenes, three-angled to 
nearly globose to flattened, 1—1.1 mm long, 
buff to dark brown, with whitish raised ridges; 
they are mosdy dropped near the mother 



plant, but are also explosively expelled up to 
4' — and probably farther, especially from 
plants growing as weeds in flower baskets 
hanging over greenhouse benches. Seeds have 
a small embrvo, with endosperm, i Description 
compiled from specimens and the following 
sources: Miller and Wood 2003; Neal 1998; 
Reed 1977; Rohwer and Berg 1993; Sanders 
1996; Thieret 1964; Wu and Kuo-Huang 1997: 
Wunderlin 1997; Yamazaki 1982; Yatskiewch 
and Raveill 2001; Zhou and Gilbert 2003). 
Known chromosome counts are n = 13 (Kon- 
do and Miller 1973) and In = 26 Li (1986). 
Plants flower from July dirough October in 
outdoor settings in the north, August through 
November in the south, and through the sum- 
mer and winter in deep south and greenhouse 
settings. 

Swain and Downum (1989, 1990) showed 
that mulberrv weed contains biologically ac- 
tive compounds, furanocoumarins, diat are 
phototoxically active toward some test organ- 
isms, such as die bacterium Escherichia coli. 

Control of the species as a weed has been 
extensively studied by Penny and Neal (1999a, 
1999b). Pre-emergence control is most effec- 
tively obtained by use of products containing 
ox\-flourfen and oxadiazon; dinitroaniline her- 
bicides differed in effectiveness. Penny and 
Neal (2003) showed that seed burial and 
mulch were 90% effective at inhibiting ger- 
mination, since germination requires light. 
Low or high temperatures may also affect ger- 
mination and development, since die species 
grew best at temperatures between 15-38°C 
(Penny 2000). Postemergence control is most 
effective using products containing paraquat, 
glyphosate, and glufosinate and perhaps also 
diquat or pelargonic acid (Pennv 2000). 

In North America, mulberry weed is re- 
ported bv Wunderlin (1997) from 17 states in 
the United States, and bv Kartesz and Mea- 
cham (1999) and the USDA Plants Database 
(USDA, NRCS 2004) for 18 states. Additional 
reports in the literature bring die number to 
26 states (Table 1). No reports are known of 
the species in Canada. It appears that die spe- 
cies is being spread dirough the horticulture 
industry, since many earlv reports are of die 
species as a weed in greenhouses, from which 
it presumably spreads by means of bedding 
plants, nursery stock, potting soil, or bedding 
mulch (Miller and Wood 2003; Pennv 2000; 



Spread ol Fatoua villosa in North America — Vincent 



m 



Table I. States in the United Stales from which Fatoua oillosa lias been reported in published literature or observed 
as herbarium specimens, Listed are the source citations, the year ol the earliest known collection examined during the 
course of this study, ami the number ol counties/parishes from which (lie species is reported (specimens ami undoi 
umented literature reports). 



Literature sourcc(s) 



Earliest 

...II-. 



Number <>t 
ties parishes 



Alabama 

Arkansas 
California 

District ol Columbia 
Florida 

Georgia 

Illinois 

Indiana 

Iowa 

Kentucky 

Louisiana 

Maryland 

Massachusetts 

Michigan 

Minnesota 

Mississippi 

Missouri 

New York 

North Carolina 

Ohio 

Oklahoma 

Oregon 

Pennsylvania 

South Carolina 

Tennessee 

Texas 

Utah 

Virginia 

Washington 

West Virginia 

Wisconsin 



M.issr\ L975 

Smith 1994; Sundell 1986 

Ilrusa el al. 2002: Randall 1997: Sanders L996; 
Baldwin ct al. 2004 

DuQuesna) 197-1: Massey 1975: Wunderlin and 

Hansen '2004 
Jones and Coile L988; Massey 1975 

Maxwell and Thomas 2003: Wunderlin 1997 
Cusick 2002 

Brownie and Athev 1992; Taylor 1994 
MacRoberts 19S9; Massey 1975; Thieret 1964; 

Thomas et al. 1980 
Wunderlin 1997 
Miller and Wood 2003 
Reznicek 2001 

Carter et al. 1990; Massev 1975 

Wunderlin 1997; Yatskievych and Raveill 2001 

Miller and Wood 2003 

Massey 1975; Neal 1998 

Vincent 1993 

Taylor et al. 1996; Taylor and Taylor 1981 



Anonymous 2004b; Wunderlin 1997 

Krai 1981; Anonymous 2004c 

Jones et al. 1997; Lipscomb 1984 

Welsh et al. 2003 

Wright 198S 

Anonymous 1996; Anonymous 2004d 

Wunderlin 1997 



1967 


S 


L985 


3 


1983 


7 


1994 


1 


1970 


17 


1965 


11 


1982 


2 


1995 


1 


2000 


1 


1983 


6 


1950 


IS 


1981 


4 


1994* 


1 


2001 


1 


199S 


1 


1972 


9 


1972 


7 


2002 


1 


1973 


7 


1979 


11 


1979 


7 


2000 


1 


1989 


1 


1975 


7 


1970 


4 


1974 


9 


1997 


1 


19S7 


4 


1995* 


1 



2002 



* = not seen. 



Penny and Neal 1999a, 1999b; Sanders 1996; 
Taylor 1994; Taylor et al. 1996; Vincent 1993; 
Welsh et al. 2003; Wunderlin 1997; Yatskiev- 
ych and Raveill 2001). Pennv (2000) and Pen- 
ny and Neal (1999a, 1999b) report 50% of 
nurseries surveyed in 1997 and 75% of nurs- 
eries surveyed in 1998 were infested by this 
weedv species. One or two generations can oc- 
cur in a growing season (Penny 2000; Pennv 
and Neal 1999a! 1999b). 

Tl lis study was undertaken to determine the 
extent to which Fatoua cillosa has spread in 
North America since its introduction, and if 
any pattern can be discerned regarding its 
spread. 



MATERIALS AND METHODS 

In addition to field work to find the species, 
herbarium specimens were examined from the 
following herbaria (acronyms from Holmgren 
2004): A, AUA. BALT, BAYLU, BH. BHO. 
BKL, BRIT, C, CDA, CLEMS, CM. DAN". 
DOY, F. FTG, GA. GH. GMUF, ID. ILL, 
ILLS, ISC. JEF, KNK. LAF. LSU, MICH. 
MIN, MISS, MISSA, MO, MONTU, MU. 
NA, NBYC, NCU, NHA, NLU. NO, NY, 
OCLA, OKL, OS, OSH, RM, SMU. TENN. 
TEX. UAM, UCR, UNA, UNLY. URY. US, 
USCH. USF VDB, VPI, VT, WIS. WSI 
WTU, WVA. 



70 



journal "I the Kentucky Acad 



Science 65(2) 




>V5>* 






Figure 2. Distribution of Fatoua villosa in North America from its initial discovery in Louisiana to the present. Each 
square (■) represents the first report of the species for a particular count)'. Dots (•) represent these first reports carried 
over from previous map(s). a. 1950-1969. b. 1970-1979. c. 1980-1989. d. 1990-2004. 



RESULTS AND DISCUSSION 

A total of 495 herbarium specimens were 
examined during the course of this study. Col- 
lections were seen from 134 counties in 28 
states, and the District of Columbia (Appendix 
1). An additional 21 counties are listed in lit- 
erature reports for which no voucher docu- 
mentation was found. Of the counties repre- 
sented by specimens, 17 were represented 
only as greenhouse weeds and not by speci- 
mens from sites out-of-doors. 

The earliest known specimen of mulberry 
weed from North America is from New Or- 
leans, Orleans Parish, Louisiana, collected in 
1950 (G. P. DeWolfs.n. [NO]). Table 1 shows 
the dates of the earliest known specimen from 
each state, as well as the number of counties/ 
parishes from which die species is known for 
each state. The state with the largest number 
of counties/parishes from which mulberry 
weed has been collected (specimens plus ad- 
ditional literature reports) is Louisiana (18), 
followed by Florida (17), Georgia (11), and 



Ohio (11). Even though the species was re- 
ported by Wunderlin (1997) for West Virginia, 
no specimen could be located to document its 
occurrence in that state. 

Based on die herbarium specimens exam- 
ined, beginning with Louisiana, from which 
the earliest collection is known (1950), the 
species appeared in the 1960s in Georgia 
(1965) and Alabama (1967). In the 1970s it 
turned up in Florida (1970), Tennessee 
(1970), Mississippi (1972), Missouri (1972), 
North Carolina (1973), Texas (1974), Soudi 
Carolina (1975), Oklahoma (1979), and Ohio 
(1979). In the 1980s, the species was found in 
Maryland (1981), Illinois (1982), California 
(1983), Kentucky (1983), Arkansas (1985), Vir- 
ginia (1987), and Pennsylvania (1989). In the 
1990s specimen were collected in DC (1994), 
Massachusetts (1994), Indiana (1995), Wash- 
ington (1995), Utah (1997), and Minnesota 
(1998). Since 2000, the species has been col- 
lected in Oregon (2000), Iowa (2000), Michi- 
gan (2001), Wisconsin (2002), and New York 
(2002). 



Spread of Fatoua villosa in North America — Vincent 



71 



When the distribution ol the specimens is 
mapped (Figure 2), an interesting pattern 
emerges with regard to the spread of the spe- 
cies in the last 50 years. Beginning with the 
earliest known collection, in New Orleans in 
1950, collections gradually radiate out to the 
southeast, east, northeast, north, northwest, 
and west. Over the next 50 years, the range of 
the species gradually increases until the pres- 
ent-day extent is reached. It cannot be dis- 
cerned from the available data whether mul- 
tiple introductions occurred into the United 
States, or if the species spread from an initial 
introduction site in New Orleans. The source 
of the initial introduction is also unknown. 

Spread of the species does seem to result 
from horticultural practices. Of the herbarium 
specimens studied, 50% are from gardens or 
flower beds, 13% are from nurseries, 12% are 
from greenhouses, 7% are from lawns, 5% are 
from potted plants, and 2% are from other 
horticultural sources (compost piles, mulch, 
soil piles). Of the remainder, sites from which 
specimens were collected included old fields, 
fencerows, cracks and crevices, railroad yards, 
roadsides, waste places, and dirt or gravel 
parking lots. Only 6% were from sites away 
from cultivated areas, where die populations 
could be considered "naturalized." 

CONCLUSIONS 

Fatoua villosa is an increasingly common 
and widespread weed in the continental Unit- 
ed States. It is apparently spreading by means 
of both plants and propagules through the 
horticultural trade. The species may also be 
spreading by other means, e.g., import of 
seeds obtained through seed indices/lists 
(Anonymous 2004a). While most of the known 
specimens are from horticultural sites, such as 
greenhouses, nurseries, and gardens, the spe- 
cies has spread from these areas into adjacent 
ones, such as lawns, fencerows, and other In- 
deral areas. From these habitats, mulberry 
weed has seemingly spread in some areas to 
more natural settings, such as forest edges and 
along streams. Since die species is able to sur- 
vive and spread in both open and shaded hab- 
itats, it may spread from horticultural and In- 
deral settings into more undisturbed sites, es- 
pecially in open forests, a habitat it occupies 
in its native range. 



ACKNOWLEDGMENTS 

I wish to thank the following individuals for 
their assistance: N. Harriman (OSH), T G. 
Lammers (OSH), J. W. Thieret (KNK). I am 
grateful to the many herbaria cited lor provid- 
ing access to specimens in their care. 

LITERATURE CITED 

Anonymous. 1996. Mulberry weed. Status: exotic in Unit- 
ed States. Nature Conservancy Priorities for Conser- 
vation January 1996:13. 

Anonymous. 2004a. Wuhan Botanical Garden Index Sem- 
iiinni 2004—2005. littp://www.\vhiob. ac.cn/englisli/web/ 
indexen.htm (accessed 15 Sep 2004). 

Anonymous. 2004b. South Carolina Plant Atlas, http:// 
cricket.biol.sc.edu/lierb/ (accessed 22 Oct 2004). 

Anonymous. 2004c. Database of Tennessee Vascular 
Plants, http://tenn.bio.utk.edu/vascular/vascular.html. 

Anonymous. 2004d. Washington State Noxious Weed Lists 
and Monitor List. http://www.mvcb.wa.gov/weed_Iist/ 
weecLlisthome.html 

Baldwin, B. G., S. Boyd. B. J. Ertter, D. J. Keil, R. W. 
Patterson, T. J. Rosatti, and D. H. Wilken. 2004. Jepson 
Flora Project. Jepson Online Interchange, http^/ucjeps. 
berkeley.edu/interchange/about_intercliange.litml 

Berg, C. C. 1977. Revisions of African Moraceae (exclud- 
ing Dorstenia, Fiats, Musanga and Myrianthus). Bul- 
letin du Jardin botanique national de Belgique 47:267- 
407. 

Blume, K. L. 1856. Museum Botanicum Lugduno-Bata- 
vum. E. J. Bril, Leiden. 2: t. 38. 

Browne. E. T., and R. Athey. 1992. Vascular plants of Ken- 
tucky: an annotated checklist. University of Kentucky, 
Lexington, KY. 

Carter, R., M. W Morris, and C. T. Bryson. 1990. Some 
rare or otherwise interesting vascular plants from the 
delta region of Mississippi. Castanea 55:40-55. 

Chew, W.-L. 1989. Moraceae. Pages 15-68 in R. Robert- 
son (ed.). Flora of Australia. Vol. 3. Hamamelidales to 
Casuarinales. Australian Govt. Pub. Service, Canberra, 
Australia. 

Correll, D. S„ and H. B. Correll. 1982. Flora of die Ba- 
hama Archipelago. J. Cramer, Vaduz, Germany. 

Cusick, A. W. 2002. Six non-native species newly discov- 
ered in the Iowa vascular flora. Sida 20:40.5—407. 

DuQuesnay, D. 1974. Fatoua villosa (Moraceae) in Flor- 
ida. Sida 5:286. 

Frevcinet. M. L. 1830 ("1826"). Voyage autourdu monde. 
P. AINE. Paris, France. 

Holm, L., J. V. Pancho, J. P. Herberger, and D. L. Pluck- 
nett. 1979. A geographical atlas ol world weeds. Wilev 
and Sons, New York, NY. 

Holmgren, P.K. 2004. Index Herbariorum. httpV/sciweb. 
n\ lig.org/sciencc2/IiRlexlIerbariorum.asp/ (accessed 22 
Oct 2004). 

Hrusa. F.. B. Ertter, A. Sanders. G. Leppig, and E. Dean. 
2002. Catalogue ol non-native vascular plants occurring 



:-2 



[ournal of the Kentucky Academy of Science fi5(2) 



spontaneous!) in California beyond those addressed in 
the [epson manual — Pari 1. Madrofio 49:61— 98. 

Hutchinson, |. 1967. The genera of flowering plants (An- 
giospennac). Dicotvledons. Clarendon Press, Oxford, 
England. 

Jeanmonod, D. 2000. Notes and contributions on Corsi- 
can flora. XVI. Candollea 55:41-74. 

Jones, S. B., and N. C. Coile. 1988. The distribution of 
the vascular flora of Georgia. Department of Botany, 
University of Georgia, Athens, GA. 

Jones, S. D., J. K. Wipff, and P. M. Montgomery. 1997. 
Vascular plants of Texas. University of Texas Press, Aus- 
tin, TX. 

Kartesz, J. T, and C. A. Meacham. 1999. Synthesis of the 
North American flora. Version 1.0. North Carolina Bo- 
tanical Garden, Chapel Hill, NC. 

Komarov, V. L. 1901. Species novae flora Asiae Orientalis 
(Manshuriae at Koreae borealis). Trudy Imperatorskago 
S.-Peterburgskago botanicheskago sada. Acta Horti Pe- 
tropolitani. 18:419-449. 

Kondo, K., and N. G. Miller. 1973. Moraceae. Fatoua vil- 
losa (Thunb.) Nakai. In: IOPB chromosome number 
reports. XXXIX. Taxon 22:115-118. 

Krai, R. 1981. Some distributional reports of weedy or 
naturalized foreign species of vascular plants for die 
soudiem states, particularly Alabama and middle Ten- 
nessee. Castanea 46:334-339. 

Kuitunen, T, and T. Lahtonen. 1994. Jyvaskylan Viherlan- 
dian kauppapuutarhan kasvihuonerikat. Greenhouse 
weeds in a market garden in Jyvaskyla, Central Finland, 
in 1984-1992. Lutukka 10:21-28. 

Leandri, J. 1948. Contribution a l'etude des Moracees de 
Madagascar. Memoires de l'Institut Scientifique de 
Madagascar, Serie B l(l):l-37. 

Lee, T. B. 1989. Illustrated flora of Korea. Hyangmunsu, 
Seoul, Korea. 

Li, L.-C. 1986. Chromosome observations of some plants 
in China. Guihaia 6:99-105. 

Liogier, H. A. 1997. Descriptive flora of Puerto Rico and 
adjacent islands: Spermatophyta/Spermatophyta — Di- 
cotyledoneae. Vol. 5. Acanthaceae to Compositae. Ed- 
itorial de la Universidad de Puerto Rico, Rio Piedras, 
PR. 

Liogier, H. A., and L. F. Martorell. 2000. Flora of Puerto 
Rico and adjacent islands: a systematic synopsis, 2nd ed. 
Editorial de la Universidad de Puerto Rico, San Juan, 
PR. 

Lipscomb, B. 1984. New additions or other noteworthy 
plants of Texas. Sida 10:326-327. 

Liu, T.-S., and J-C. Liao. 1976. Moraceae. In: H.-L. Li 
(ed.). Flora of Taiwan. Epoch, Taipei, Taiwan. 2:117— 
161. 

MacRoberts, D. T. 1989. A documented checklist and at- 
las of the vascular flora of Louisiana. Dicotyledonae: 
Fagaceae to Zygophyllaceae. Bulletin of the Museum of 
Life Sciences, University of Louisiana, Shreveport, LA. 
No. 9. 

Massey, J. R. 1975. Fatoua villosa (Moraceae): additional 



notes cm distribution in the southeastern states. Sida 6: 
116. 

Maxwell, R, II., and W. E. Thomas. 2003. Distribution 
records of southern Indiana vascular plants. Proc. Ind. 
Acad. Sci. 112:22-28. 

Miller, N. C, and C. E. Wood. 2003. The Asian weed 
Fatoua villosa (Moraceae) in New York state and Mas- 
sachusetts. Rhodora 105:286-291. 

Miquel, F. A. G. 1869. Observationes de Urticeis quibus- 
dam et de Fatoua. Annales Museum Botanicum Lug- 
duno-Batavum 4:301-307. 

Nakai, T 1927. Notulae ad plantas Japonicae et Koreanae. 
XXXIV. Botanical Magazine (Tokyo) 41:501-522. 

Neal, J. C. 1998. Mulberry weed or hairy crabweed (Fa- 
toua villosa). Weedlnfo Fact Sheet 03. Horticulture In- 
formation Leaflet 903. Department of Horticultural 
Science, College of Agriculture and Life Sciences, 
North Carolina Cooperative Extension Service, North 
Carolina State University. 

Ohwi, J. 1965. Flora of Japan (in English). Smithsonian 
Institution, Washington, DC. 

Penny, G. M. 2000. Biology and management of Mulberry 
weed, Fatoua villosa (Thunb.) Nakai. M.S. Thesis, Hor- 
ticultural Science. North Carolina State University, Ra- 
leigh, NC. 

Penny, G. M., and J. C. Neal. 1999a. Mulberry weed (Fa- 
toua villosa): a new weed in landscapes and container 
nursery crops. Proc, So. Weed Sei. Soc. 52:82. 

Penny, G. M., and J. C. Neal. 1999b. Preemergence con- 
trol of mulberry weed (Fatoua villosa) in containers. 
Proceedings of the Southern Nurserymen's Association 
Research Conference 44:382-^383. 

Penny, G. M., and J. C. Neal. 2003. Light, temperature, 
seed burial, and mulch effects on mulberry weed (Fa- 
toua villosa) seed germination. Weed Tech. 17:213- 
218. 

Randall, J. M. 1997. Weed alert! New invasive weeds in 
California. California Exotic Pest Plant Council. 1997 
Symposium proceedings: 1-6. 

Randall, R. P. 2002. A global compendium of weeds. R. 
G. and F. J. Richardson, Victoria, Australia. 

Reed, C. F. 1977. Economically important foreign weeds: 
potential problems in the United States. USDA Agri- 
cultural Handbook No. 498. Washington, DC. 

Reznicek, A. A. 2001. Mulberry weed (Fatoua villosa) 
spread as far north as Michigan. Michigan Botanist 40: 
73-74. 

Rohwer, J. G., and C. C. Berg. 1993. Moraceae. Pages 
438-453 in K. Kubitzki, J. C. Rohwer, and V Bittrich 
(eds). The families and genera of vascular plants. Vol. 
2. Flowering plants: Dicotyledons: Magnoliid, Hama- 
melid and Caryophyllid families. Springer- Verlag, Ber- 
lin, Germany. 

Sanders, A. C. 1996. Noteworthy collections: California: 
Fatoua villosa (Thunb.) Nakai (Moraceae). Madrono 
43:527. 

Smith, E. B. 1994. Keys to the flora of Arkansas. Univer- 
sity of Arkansas Press, Fayetteville, AR. 



Spread ol Faloua villosa in North America — Vincent 



SiiihI.II. E. L986. Noteworthy plants from Arkansas. Cas- 

tanca 51:21 1-215. 

Swain. L. A., and K. R. Downum. L989. Biologically active 
coumarins of the Moraceae (fig family). Abstracts of 
Papers— American Chemical Society L98: AGRO LOO. 

Swain, L. A., and K. R. Downum. 1990. Liglit-activated 
toxins in the Moraceae. Biochemical Systematics and 
Ecology 18:153-156. 

Taylor, C. E. S., L. K. Magrath, P. Kolley. P. Buck, and S. 
Carpenter. 1996. Oklahoma vascular plants: additions 
and distributional comments. Proc. Okla. Acad. Sci. 76: 
31-34. 

Taylor, D. D. 1994. Mulberry weed — a new weedy pest 
in Kentucky. Kentucky Native Plant Society Newsletter. 
9(3):3-l, 10. 

Taylor, R. J. and C.E. Taylor. 1981. Plants new to Arkan- 
sas, Oklahoma and Texas. Sida 9:25-28. 

Thieret, J. W. 1964. Fatoua villosa (Moraceae) in Louisi- 
ana: new to North America. Sida 1:248. 

Thomas, R. D„ P. B. Pias Cox, N. A. Dawson, and R. C. 
Gough. 1980. A checklist of the vascular plants of 
Morehouse, Richland, and West Carroll parishes of 
northeast Louisiana. Contributions of the Herbarium of 
Northeast Louisiana University 1:1-67. 

Thunberg, C. P. 1784. Flora Japonica. I. G. Miilleriano, 
Lipsiae. 

USDA, NRCS. 2004. The PLANTS Database, Version 3.5 
(http://plants.usda.gov). National Plant Data Center, 
Baton Rouge, LA 70874-4490 USA. 

Vincent, M. A. 1993. Fatoua villosa (Moraceae). mulberry 
weed, in Ohio. Ohio J. Sci. 93:147-149. 

Walker, E. H. 1976. Flora of Okinawa and the Southern 
Ryukyu Islands. Smithsonian Institution Press, Wash- 
ington, DC. 

Welsh, S. L„ N. D. Atwood, S. Goodrich, and L. C. Hig- 
gins. 2003. A Utah flora, 3rd ed. Monte L. Bean Life 
Science Museum, Brigham Young University, Provo, 
UT. 

Wright, R. A. S. 1988. Noteworthy collections: Virginia. 
Faloua villosa (Thunberg) Nakai. Castanea 53:242. 

Wu, C.-C, and L.-L. Kuo-Huang. 1997. Calcium crystals 
in the leaves of some species of Moraceae. Botanical 
Bulletin of Academia Sinica 38: 97-104. 

Wunderlin, R. P. 1997. Fatoua. Pages 389-390 in Flora of 
North America Editorial Committee (eds). Flora of 
North America. Vol. 3. Magnoliophyta: Magnoliidae 
and Hamamelidae. Oxford University Press, New York, 
NY. 

Wunderlin. R. P.. and B. F Hansen. 2004. Atlas of Florida 
vascular plants (http://www.plantatlas.usf.edu/). [S. M. 
Landry and K. N. Campbell (application development), 
Florida Center for Community Design and Research.] 
Institute for Systematic Botany, University of South 
Florida. Tampa, FL. 

Yama/aki, T. 1082. The seed formation of Fatoua villosa 
(Moraceae). J. Jap. Bot. 57:350-365. 

Yatskievych, G, and J. A. Raveill. 2001. Notes on the in- 
creasing proportion of non-native angiosperms in the 



Missouri flora, witb reports of three new genera lor the 
state. Sida 19:701-709. 
Zhou, /.. and M. G. Gilbert. 2003. Moraceae. Pages 21- 
73 iii Z, Wu, I' II. Raven, and I) Hong (eds). Flora "l 
China. Vol. 5. Ulmaceae through Basellaceae. Science 
Press, Beijing and Missouri Botanical Garden, St. Lou- 
is, MO. 

APPENDIX 

Selected Specimens Examined 

(only 1 specimen per county; * = greenhouse 
weed) 

ALABAMA: Chambers County, L. Dalrymple s.n. 
(AUA); Conecuh County, A.R. Diamond 3650 (CA, NLU); 
Elmore County, E.R. Bums s.n* (AUA); Lee County, 
J.M. Moffett s.n. (TENN); Madison County. C.T. Bryson 
J7.529 (USCH); Mobile County. K.E. Rogers 1819 b 
LeLong (NCU); Pike County, A.R. Diamond 5330 (AUA); 
Sumter County, R.D. Thomas 100747 b Pitlman (NLU, 
NY). 

ARKANSAS: Drew County, E. Sundett 6S34 b Culdin 
(BRIT, NLU, UAM); Pulaski County, E. b M. Sundett 
12049 (NLU, UAM); Union County, R.D. Thomas 107891 
et al. (MO, TENN). 

CALIFORNIA: Alameda County, R.D. Raabe b Stroth- 
er s.n.* (A); Kern County, Lapp et al. s.n. (CDA); Riv- 
erside County, A.C. Sanders 15S32 (UCR); San Bernar- 
dino County, M. Cohen s.n. (CDA); San Diego County. F. 
McCutcheon s.n. 6- Avery (CDA); Santa Barbara County. 
K. Cheesman s.n. (CDA). 

DISTRICT OF COLUMBIA: Washington, S. McNaull 
141 b Csiba (MU). 

FLORIDA: Broward County, M.A. Vincent 10998 b 
Hickey (MU); Citrus County, E Damian s.n. (GH, NCU); 
Dade County, /. Popenoe 867 (FTG, NCU); Franklin 
County, L.C. Anderson 8671 (MO); Hillsborough County. 
J.M. Kunzer 556 (USF); Leon County. R.K- Godfrey 
72357 (GA, MO, NCU, NY, TENN); Monroe County.;. 
Popenoe 1979 (FTG, NCU); Pasco County, D. Du- 
Quesnay s.n. (A, CM, FTG, GA, MIN, NCU, NLU, SMU, 
USF); Sarasota County,/. Popenoe 1979 (USF). 

GEORGIA: Bibb County, JR. Allison 3514 (GA); 
Clarke County, W.H. Duncan s.n* (GA, LSU); Columbia 
County, /. Allison 942 (BH, GA, MO, NCU); Fulton 
County, R.D. Thomas 101286 et al. (NLU); Glynn County, 
W.H. Duncan 30555 (GA, MO); Gwinnett County, SB. 
Jones 22525 (GA, NCU); Jones County. W.H. Duncan 
30564 (GA, WIS); Lowndes County. WR. Faircloth 6736 
(GA, MO, NCU); Sumter County, R.A. Norris 6710 (GA, 
NLU); Walker Counh, W.H. Duncan 30647 (MO). 

ILLINOIS: Champaign County, S.R. Hill 33109 (BRIT, 
MU. NY, TEX, VT); Jackson County, A.C. Knelling 696S 
(ILL). 

INDIANA: Floyd County. Maxwell s.n. (JEF). 

IOWA: Muscatine County, A.W. Cusick 35602 Ml 
OSH). 

KENTUCKY: Adair County, J.W. Thieret 60461 ik\K 



74 



il of the Kentucky Academy "I Science 65(2) 



Campbell County, /.W Thieret 57160 (KNK); Jefferson 

C tv. M Medley 9311-83 (KNK); Madison Count) 

M.A. Vincent 7163 (KNK. MO, MU). 

LOUISIANA: Caddo Parish, R.D. Thomas 166976 & 
Raymond (NLU); Calcasieu Parish, R. Ni'i/land 1143 
(LSU); Concordia Parish, R.D. Thomas 24566 (NCU, 
NLU, TENN); East Baton Rouge Parish, S. Tucker s.n. 
(LAF, LSU, NLU, TEX); Iberia Parish, R.D. Thomas 
19706 et id. (NLU); Jefferson Parish, T. Zebryk 3297 
(NLU); Lafayette Parish, J.W. Thieret 16171 (A, LAF, 
SMU); Lafourche Parish, R.D. Thomas 79963 et al. 
(BRIT, NCU, NLU); Lincoln Parish, A.W. Boyd 3208 
(NLU); Morehouse Parish, R.D. Thomas 56634 b Pias 
(NLU); Natchitoches Parish, W.C. Holmes 4001 (NLU, 
NO); Orleans Parish,/. Ewan 23056 (NO, WIS); Ouachita 
Parish, R.D. Thomas 17629 (GA, ILL, NLU, USF, WTU); 
Rapides Parish, E. McWilliams M539024 (NLU); St. 
Charles Parish, G. Montz 5294 (BRIT, LSU, LAF, NLU, 
NO); St. John Parish, G.N. Montz 5946 (LSU, NLU, NO); 
St. Tammany Parish, T. Zebnjk 3301 (NLU); Tangipahoa 
Parish, G.N. Montz 8932 (LSU, NLU, NO). 

MARYLAND: Baltimore County, C.F. Reed 111095* 
(MO); Harford County, C.F. Reed 126949* (MO); How- 
ard County,/. Duke s.n. (NA); Montgomery County, EG. 
Meyer 22475 (A). 

MICHIGAN: Jackson County, A.A. Reznicek 11300 
(DOV, GH, ILLS, MO, MU, OSH). 

MINNESOTA: Anoka County, B.A. Addison s.n.* 
(MIN). 

MISSISSIPPI: DeSoto County, C.T. Bryson 18056 et 
al. (NLU, TENN); Forrest County. K.E. Rogers 7902 
(NCU); Franklin County, C. Havran 1238 (MISS, MIS- 
SA); Grenada County, C.T. Bryson (TENN); Lafayette 
County, M.S. Huneycutt s.n. (MISS); Monroe County, J.R. 
MacDonald 9258 et al. (DOV); Oktibbeha County, C.T. 
Bryson 19176 ir Bryson (CM, DOV, MO); Pearl River 
County, C.T. Bryson 16933 it Sudbrink (MISS); Washing- 
ton County, C.T. Bryson 15655 (GA, KNK, MO, NLU, 
TENN, UNLV). 

MISSOURI: Boone County, P.M. McKenzie 1629 
(MO); Butler County, S. Hudson 956 (MO); Cape Girar- 
deau County, T.E. Brooks s.n. (MO); Cole County, T.E. 
Smith 3605 (MO); St. Louis County, M.A. Vincent 6443 
(MO, MU). 

NEW YORK: Rensselaer County, N.G. Miller 15565 
(GH, MU). 

NORTH CAROLINA: Brunswick County, M.A. Vin- 
cent 8681 (BAYLU, C, DAV, ID, ILLS, MU, NCU, OSH, 
TEX); Cherokee County, E. Lunsford s.n. ir- Morrow 
(NCU); Dare County, M.A. Vincent 9437 (MU); Durham 



County, C.F. Reed 116878* MO Iredell County//! 
Nelson 2809 6 Wnek (NCU); Mecklenburg County, J.F. 
Matthews s.n. (NCU); Moore County, B.A Sortie 9363 
(GH, NCU). 

OHIO: Athens County, J.W. Thieret 56353* (KNK 
Butler County. M.A. Vincent .5693 (BIIO. MICH, MO, 
MU, NY, OS, US, USF); Darke County M.A. Vincent 
lltltll et al. (MU); Delaware County, AW Cusick 35744 
(MU); Franklin County, A.W Cusick 30637 6 Shelton 
(MU, OS); Hamilton County, M.A. Vincent 7997 (MU, 
OS); Lawrence County, A.W. Cusick 34753 (CM, MU, 
NY); Meigs County, A.W. Cusick 35026 (MU); Musking- 
um County, L.E. Brown 9235* (BRIT); Portage County, 
A.W. Cusick 32216* (MU); Washington County, A.W. 
Cusick 30632 6- Ortt (MU, OS). 

OKLAHOMA: Bryan County, C. Taylor 36151* (OKL); 
Carter County, A. Buthod 4372 et al. (OKL); Grady Coun- 
ty, L.K. Magrath s.n. (OKL); McCurtain County, C. Citty 
s.n. (NLU). 

OREGON: Benton Count)', R.R. Hahe 5718* (NY). 

PENNSYLVANIA: Allegheny County, S.A. Thompson 
6354* (CM). 

SOUTH CAROLINA: Florence County, L. Swails s.n. 
(USCH); Georgetown County, /.B. Nebon 21469 (USCH); 
Greenville County, N.E. Mullins 75318 (NLU); Lexington 
County, J.B. Nelson 11950 (USCH); Newberry County, 
C.N. Horn 4294 (USCH); Pickens County, S.R. Hill 20097 
(BRIT. GH, MO, NY. USF); Richland County, J.B. Nelson 
5737 (USCH). 

TENNESSEE: Davidson County, M. Guthrie 609 
(TENN); Hamilton County, /.T. Beck 3866 (TENN); Knox 
County, A.W. Cusick 32241* (MU); Shelby County, A. 
Evans s.n. (MO, NLU, TENN). 

TEXAS: Austin County, M.H. Mat/field 1776 et al. 
(BRIT, MO, TEX); Bexar County, M.A. Vincent 4943 
(ILL, MO, MU); Blanco County, R.W. Sanders 5563 
(BRIT); Brazoria County, R.J. Fleetwood 11180* (SMU); 
Collin County, S.R. Hill 4539* (GH); Dallas County, B.L. 
Lipscomb 3386 (LSU, MU); Gillespie County, R.W. Sand- 
ers 5339 (BRIT); Harris County, L.E. Brown 8466 (NLU, 
SMU); Tarrant County, B. Lipscomb 3472 (BRIT). 

UTAH: Washington County, L. Higgins 19902 (MO, 
NY). 

VIRGINIA: Chesterfield County, W.J. Hayden 3553 
(NLU, URV); City of Lynchburg, C. Leys s.n. (MO, MU); 
Fairfax County, T. Darling s.n. (GMUF); Richmond 
County, R.A.S. Wright 2417 (VPI). 

WISCONSIN: Winnebago County, M.A. Vincent 10805 
6 Lammers* (MU, OSH). 



List ill Recent Reviewers 



75 



We gratefully acknowledge the contribution of time and expertise provided !>y the following 
individuals in reviewing manuscripts submitted for consideration by the Journal. 



J. Richard Abbott 
Charles A. Acosta 
George W. Argus 
John R. Raird 
Richard L. Royce 
David M. Brandenburg 
Wayne Bresser 



Jerry H. Caqienter 
James Duval] 
Richard L. Josephs 
Robby Lee 
[ames O. Luken 
Joseph I. Orban 
Mark Pvron 



Thomas C. Rambo 
Matt W. Raymond 
Thomas Sproat 
David D. Taylor 
Jerry W. Warner 
Maiy Kathryn Whitson 



I kx Vcad Sci 65 2 :76 M 2004. 

Distributional Records of Selected Kentucky Fishes 

Michael C. Compton,' David J. Eisenhour, 5 Ronald R. Cicerello, 3 
Lewis E. Kornman, 4 Albert Surmont Jr.,' and Ellis I,. Laudermilk 3 

Kentucky Division of Water, Frankfort, Kentuck) 40601 
'Department of Biological and Environmental Sciences, Morehead State University, Morehead, Kentucky 40351 

'Kentucky State Nature Preserves Commission. Frankfort. Kentucky 40601 
'Kentucky Department of Fish and Wildlife Resources, Northeast Fisheries District, Morehead, Kentucky 403.5 1 

ABSTRACT 

Distributional records for 14 species of fishes are included for Kentucky. Phoxinus oreas is recorded for 
the first time from Kentucky (Big Sandy River drainage, Pike Co.). Reported for the first time are drainage 
records for Ichthyomyzon unicuspis and Clinostomus funduloides (Licking River drainage, Batli/Rowan and 
Morgan cos., respectively); Scaphirhynchus platorynchus (Kentucky Riser drainage, Franklin and Henry/ 
Owen cos.); Cyprinella gidactura (Green River drainage, Barren Co.); Notropis maculatus (Tennessee River 
drainage. Graves Co.); and Forbesichthys agassizii (Tradewater River drainage, Caldwell Co. and Crooked 
Creek system, Crittenden Co.). Range extensions in the upper Cumberland River drainage for Etheostoma 
crossopterum, E. nigrum, and E. percnurum (Clinton, Pulaski, and McCreary cos., respectively) and for 
Etheostoma chlorosoma in the Green River drainage (Ohio Co.) are reported. The continued occurrence of 
the rare fishes Acipenser fulvescens (Ohio River, Lewis Co.), Notropis maculatus (Obion Creek system, 
Hickman Co.), Noturus exilis (lower Cumberland River drainage, Trigg Co.), and Lota Iota (Ohio River, 
Bracken, Jefferson, and Livingston cos.) is noted. 



INTRODUCTION 
Kentucky has the fourth highest fish diver- 
sity in the United States, behind Alabama, 
Georgia, and Tennessee. Clay (1975) reported 
ca. 200 species occurring in tire state; Burr 
and Warren (1986), 242 species. During die 
past 18 years die state total has increased with 
the resolution of several species complexes 
(Ceas and Page 1997; Page et al. 1992; Page 
et al. 2003; Wood et al. 2002). Continued 
monitoring of the distribution and status of 
the fish fauna is necessary for resource man- 
agers in species conservation planning and res- 
toration efforts. In recent vears, Burr et al. 
(1990), Warren et al. (1991), Cicerello and 
Laudermilk (1996), Ryon and Carrico (1998), 
and Eisenhour and Burr (2000) provided in- 
formation on the status and distribution of 
several species. However, collections by uni- 
versity and state agency personnel, and re- 
cords of species from sport and commercial 
fishing infrequently get reported outside of 
"gray" literature. Herein, the presence of one 
new species, substantial range extensions of 
several species, and current status information 
of some rare species for Kentucky is noted. 

MATERIALS AND METHODS 
All records reported were from collections 
made within die past 10 years by the authors 



or personnel from the Kentucky Division of 
Water (KDOW) or die Kentucky Department 
of Fish and Wildlife Resources (KDFWR), 
unless noted otherwise. Specimens were col- 
lected via seining or backpack eleetrofishing, 
unless noted otherwise. Preserved specimens 
were deposited at die Illinois Natural Historv 
Survey (INHS), Morehead State University 
(MOSU), or Southern Illinois University at 
Carbondale (SIUC). For specimens not 
vouchered in museum collections, die authors 
confirmed identification by personal examina- 
tion of the specimens or examination of pho- 
tographs. Common and scientific names for 
each species follow Nelson et al. (2004). 
Lengths are reported in standard length (SL) 
or total length (TL). Species accounts provide 
museum catalog number, number of speci- 
mens and their size range (in parentheses), 
stream name, receiving stream watershed (in 
parentheses), locality county, and collection 
date. 

RESULTS 
Silver Lamprey 
Ichthyomyzon unicuspis Hubbs and Trautman 

MOSU 1588 (1; 111 mm TL), Licking River 
(Ohio River), in tailwaters below Cave Run 
Lake dam, Bath/Rowan cos., 23 Mar 2000. 



76 



Distributional Records — Campion <i al. 



77 



Remarks: Ichthyomyzon unicuspis previ- 
ously was unknown from the Licking River 
drainage. Bun- and Warren (1986) reported 
this species as "often common" in the Ohio 
River but rare in streams of the remainder of 
the state. The specimen was a subadult at- 
tached to a muskellunge (Esox masquinongy) 
at the time of collection. The individual may 
indicate the presence ol a reproducing popu- 
lation of /. unicuspis in the middle Licking 
River, or it may have been transported some 
distance bv its host. Suitable spawning habitat 
appears to be present, although spring surveys 
in the Licking River by DJE revealed the pres- 
ence of only /. bdellium (Ohio lamprey). 
Ichthyomyzon fossor. the "satellite species" of 
/. unicuspis (Hubbs and Trautman 1937), is a 
small-stream species not known from the 
Licking River drainage, so Ichthyomyzon am- 
moecetes from the Licking River mainstem 
with fewer than 53 myomeres are likely to be 
/. unicuspis. 

Lake Sturgeon 

Acipenser fulvescens Rafmesque 

MOSU 1654 (1; 791 mm SL), Ohio River 
(Mississippi River), 60 m upstream of conflu- 
ence witli Kinniconick Creek, Lewis Co., 3 
Jun 2000. 

Remarks: Acipenser fulvescens was common 
in the upper Ohio River prior to 1915 but un- 
derwent a decline nearly to die point of extir- 
pation by 1950 (Trautman 1981). The near ab- 
sence of tiiis species in collections from die 
middle part of the 20th century led Pearson 
and Pearson (1989) to consider it extirpated 
from the Ohio River. Outside of the Ohio and 
Mississippi rivers, vouchered records from 
Kentucky are rare; the only vouchered speci- 
men we are aware of is a 1954 record (UL 
7053) from the Cumberland River (Whitiey 
Co.) (Burr and Warren 1986). Our record was 
an untagged specimen from die Ohio River 
caught bv angling from the Kentucky bank. 
We are aware of three additional recent rec- 
ords from the Ohio River in Kentucky, includ- 
ing a tagged specimen, 118 cm TL and 12.1 
kg, identified by D. Henley (KDFWR), from 
the Ohio River just above the confluence ol 
the Wabash River, Union Co., Kentucky on 7 
Mar 2000. The two other specimens, both ver- 
ified by B. M. Burr (SIUC) from photographs. 



include one from south ol Grand Chain. Pu- 
laski Co., Illinois and Ballard Co., Kentucky, 
1988 (Burr et al. 1990), and the other caught 
and released alive below Sn lit I iluncl Dam. Liv- 
ingston Co., Kentucky, in April or May 1992 
(B. Burr pers. coram. 2003). An additional 
specimen, ca. 120 cm TL and IS. 5 kg, verified 
from photographs by DJE, was caught and re- 
leased alive in late 2002 from the Mississippi 
River 4.8 km S of Columbus, Hickman Co., 
Kentucky. 

It is possible that recent specimens repre- 
sent a remnant Ohio River population, al- 
though they may have originated from Mis- 
souri or Indiana. Acipenser fulvescens has 
been stocked in the Mississippi and Missouri 
rivers in Missouri for 20 years (B. Fisher. In- 
diana Department of Natural Resources 
(IDNR), pers. comm., 7 Jan 2004), allowing a 
population to build in that state. Fisher has 
been studying what appears to be a native, re- 
producing population in the East Fork of 
White River in Indiana. This population, 
though small, appears stable and consists of 
diverse age classes. The tagged specimen col- 
lected from die mouth of the Wabash River 
originated from this population, suggesting 
diat at least some of the specimens from the 
lower Ohio River may have migrated from In- 
diana. The juvenile (MOSU 1654) recently 
collected from the upper Ohio River is the 
first specimen collected from that part of the 
river in more than 60 years; its origin is un- 
known. Although these records document the 
continued presence of A. fulvescens in the 
Mississippi and Ohio rivers, it remains a very 
rare fish in the state and we recommend its 
Kentucky listing as endangered (KSNPC 
2000) be' continued. 

Shovelnose Sturgeon 

Scaphirhynchus platorynchus i Rafmesque) 

Photo record (1; ca. 700 mm SL). Kentucky 
River (Ohio River). Pool 4 at Frankfort. RKM 
104-105, Franklin Co., 10 May 2000: photo 
record (1; ca. 700 mm SL). Kentucky River 
(Ohio River), Pool 1. 1.6 km X of Eagle Creek 
mouth. RKM 16-17, Owen/Henry cos.. 10 
May 2000. 

Remarks: All specimens were killed as a re- 
sult of a large bourbon spill into the Kentucky 
River. Identifications of this distinctive species 



78 



Journal of the Kentucky Academy of Science 65(2) 



were verified from photographs provided to 
DJE by W. Davis and K. Prather (KDFWR). 
Substantiated records in Kentucky are nearly 
absent outside of the Ohio and Mississippi riv- 
ers, although the presence of S. platorynchus 
in other large rivers of the state has been sus- 
pected (Burr and Warren 1986). Previous re- 
ports (Welter 1938) suggest it was once more 
common in these rivers, but anthropogenic 
changes have apparently reduced their popu- 
lations. Locks and dams, common modifica- 
tions of Kentucky's large rivers, contribute to 
sturgeon declines by preventing gene flow 
among populations, blocking migrations to 
critical spawning or feeding habitat, and alter- 
ing flow regimens (van Winkle et al. 2002). 
The presence of S. platorynchus offers some 
hope that this species may also be present in 
other large, interior rivers of the state (e.g., 
Licking and Green), although it is likely to be 
rare, as it is in the Kentucky River. 

Rosyside Dace 

Clinostomus funduloides Girard 

MOSU 1486 (1; 53 mm SL), North Fork 
Licking River (Licking River), at mouth of 
Bucket Branch, 3 km N of Leisure, Morgan 
Co., 19 Jul 1999. 

Remarks: This is the first record of C. fun- 
duloides from the Licking River drainage. This 
species is native and common in the adjacent 
headwaters of the Little Sandy River (Burr 
and Warren 1986). Introduction by bait-buck- 
et release seems likely because the specimen 
was taken at a fishing access and the close 
proximity (by road) to populations of C. fun- 
duloides. The closely related and morpholog- 
ically similar redside dace, Clinostomus elon- 
gatus, is present in most of Bucket Branch, 
but we have not taken it in the lower 80 m of 
Bucket Branch or in adjacent reaches of North 
Fork Licking River. 

Whitetail Shiner 
Cyprinella galactura (Cope) 

SIUC 33260 (5; 36^2 mm SL), Falling 
Timber Creek (Skaggs Creek), at KY 90, Bar- 
ren Co., 17 Apr 1996; SIUC 51098 (3; 32-35 
mm SL), Falling Timber Creek, at KY 90, Bar- 
ren Co., 11 Feb 1998; SIUC 51094 (1; 34 mm 
SL), Falling Timber Creek, at KY 63, Barren 
Co., 17 Apr 1996; SIUC 51093 (3; 46-73 mm 



SL), Falling Timber Creek, at Glover Road 
ford, Barren Co., 10 Jul 2001. 

Remarks: Cyprinella galactura inhabits the 
Big Sandy River drainage and the Cumberland 
River drainage from above the Cumberland 
Falls west to the Red River system (Burr and 
Warren 1986). The Big Sandy population is 
considered a probable introduction (Warren 
1981; Burr and Warren 1986), but Powers and 
Ceas (2000) reported that it is generally dis- 
tributed and abundant in Russell Fork and 
provided evidence in support of native status 
in the drainage. Our records are the first for 
C. galactura in the Green River drainage. The 
provenance of this species in the Green River 
is unclear but it could be the result of stream 
capture or bait-bucket introduction. Cyprinel- 
la galactura is one of several fish taxa (e.g., 
Nocomis effusus and Notropis telescopus) and 
a crayfish (Cambarus cumberlandensis) found 
in the upper Barren and Green rivers that typ- 
ically inhabit the Cumberland River drainage 
(Warren and Cicerello 1983; Burr and Warren 
1986; Lawson 2003). Falling Timber Creek is 
near areas identified as possible dieaters of 
stream capture and faunal exchange between 
the upper Barren and Green rivers and Cum- 
berland River tributaries (Lachner and Jenkins 
1971; Warren and Cicerello 1983). The upper 
Barren and Green rivers are relatively well 
collected, and C. galactura apparently is re- 
stricted to Falling Timber Creek. A restricted 
distribution could result from bait-bucket in- 
troduction as well as stream capture. Addi- 
tional research is required to resolve the status 
of C. galactura and other taxa shared by the 
Green and Cumberland rivers. 

Taillight Shiner 
Notropis maculatus (Hay) 

MOSU 1979 (17, 43-51 mm SL), Little Joe 
Cr. (Obion Creek), along KY 307, 2.7 km S of 
Beulah, Hickman Co., 21 Jun 2003; SIUC 
51097 (51, 22-31 mm SL), Three Ponds, 
(Obion Creek), 2.25 km SW of Hailwell, Hick- 
man Co., 8 Sep 2003; MOSU 2195 (10, 45- 
60 mm SL), West Fork Clarks River (Tennes- 
see River), old channel at KY 131, Graves Co., 
16 Jul 2004. 

Remarks: Notropis maculatus is a state- 
threatened species (KSNPC 2000) that pri- 
marily occupies undisturbed oxbow lakes, 



Distributional Records — Campion el at 



79 



swamps, and low-gradient streams. Prior Ken- 
tucky records are available only from these 
habitats in the Mississippi Alluvial Plain and 
Ohio River Bottomlands (Burr and Warren 
1986). The new records expand the Kentucky 
distribution well into the Coastal Plain and 
represent the first records in the Obion Creek- 
system since 1890 (Woolman 1892) and the 
first record in the Tennessee River drainage. 
It is somewhat surprising this species was not 
reported earlier from the adjacent Murphy's 
Pond area, considering that tbis area has been 
relatively well sampled and that N. maculatus, 
along with the state-endangered Hybognathus 
hayi (KSNPC 2000), were the two most com- 
mon cyprinids at the site. In addition, prior 
collecting efforts in the Clarks River system 
did not reveal N. maculatus (Sisk 1969). Per- 
haps the difficult)' of sampling the woody, de- 
bris-filled waters that N. maculatus typically 
occupies and the general rarity of the species 
explains why it has not been previously re- 
ported from diese areas. The limited habitat 
unaffected by channelization in the Coastal 
Plain has not been thoroughly sampled and 
intensive collecting efforts may reveal N. ma- 
culatus to be more widely distributed. 

Mountain Redbelly Dace 
Phoxinus oreas (Cope) 

SIUC 42429 (4; 32-54 mm SL), Abes Fork 
(Grassy Creek, Virginia), 0.1 km above Trace 
Fork, Pike Co., 7 Jul 1999. 

Remarks: Phoxinus oreas is native to the 
central Atlantic slope from the York River 
south to Neuse River and to the upper New 
River in the Ohio River basin (Hocutt et al. 
1986; Jenkins and Burkhead 1993). Because of 
its popularity with bait fishermen, P. oreas has 
been introduced into or is of questionable na- 
tive status in additional Atlantic slope drain- 
ages and in the upper Tennessee River drain- 
age. Two specimens collected by Powers and 
Ceas (2000) from Grassy Creek, a Russell 
Fork tributary in Buchanan Co., Virginia, rep- 
resent the first Big Sandy River drainage re- 
cord. Close proximity to a bait dealer and ab- 
sence of this species elsewhere in the drainage 
suggest this record is a probable bait-bucket 
introduction (Powers and Ceas 2000). Our col- 
lection from Abes Fork, a 2-3 m wide head- 
water tributary to Grassy Creek, is the first 



Kentucky record. Additional specimens were 
observed in Trace Fork, a northern tributary 
to Grassy Creek in Kentucky, but were not 
retained. The presence of a brightly colored 
male and gravid females in Abes Fork suggests 
this is a reproducing and probably established 
population. As judged from Powers and Ceas 
(2000) and other recent collections in the Big 
Sandy drainage (e.g., KDOW, KSNPC), P. or- 
eas apparently is localized in Russell Fork. 
However, additional collecting in headwater 
streams is needed to establish its distribution 
in the drainage. 

Slender Madtom 
Noturus exilis Nelson 

SIUC 43166 (1; 79 mm SL), Donaldson 
Creek (Cumberland River), 0.5 km upstream 
of KY 164 bridge, Trigg Co., 19 Jun 2001. 

Remarks: Donaldson Creek was one of the 
10 localities reported by Burr and Warren 
(1986) for the state-endangered Noturus exilis 
(KSNPC 2000). Kornman (1995) found an ad- 
ditional locality in the South Fork Licking Riv- 
er (Pendleton Co.) but speculated that die 
specimens may be an undescribed form be- 
cause of their unique morphology. Excluding 
Kornman (1995), the most recent collection of 
N. exilis was in 1983 from Kentucky Lake 
(Calloway Co.) and the species has not been 
reported from natural habitat since 1968 (Burr 
and Warren 1986). 

Two specimens were collected on 19 Jun 
2001 but occurred apart from each other. Af- 
ter examination, die second specimen was re- 
leased, because the first specimen was already 
retained as the voucher (SIUC 43166). Both 
specimens were collected from cobble/gravel 
substrate in swift water. The vouchered spec- 
imen was a gravid female and the released 
specimen appeared to be male. The presence 
of a gravid female and a male is encouraging 
that the species still spawns in die state; how- 
ever, N. exilis is among die rarest fishes in 
Kentucky and further efforts are needed to 
fully understand its current status in the state. 

Spring Cavefish 

Forbesichtlu/s agassizii (Putnam) 

SIUC 51051 (1; 66 mm SL). Pinev Creek 
(Tradewater River), 0.15 km above an un- 
named tributary, near Haile Road ford. Cald- 



SI I 



[ournal ol the Kentuckv Acudcmv nl Science 65(2 



well Co.. 16 Apr 2002. MOSU 2232 I L; 60 mm 
SL), Rush Creek (Crooked Creek), 0.4 km be- 
low US 60 and KY 641, Crittenden Co., 8 fun 
2004. 

Remarks: These are the first records for 
Forbesichthys agassizii from die Tradewater 
River drainage and the Crooked Creek system 
(minor Ohio River tributary). Burr and War- 
ren (1986) described F. agassizii as "sporadic 
to occasional and at times abundant" in the 
Cumberland. Green, and Tennessee river 
drainages within the Highland Rim and Shaw- 
nee Hills regions. As with other members of 
the family Amblvopsidae, F agassizii is asso- 
ciated with cave systems and spring-fed 
streams (Burr and Warren 1986) within the 
karst subecoregions, Crawford-Mammoth 
Cave Uplands, Western Highland Rim, and 
Western PenmToval Karst Plain (Woods et al. 
2002). Piney Creek and Rush Creek originate 
in die Crawford-Mammoth Cave Uplands su- 
becoregion and the new records fill in distri- 
butional gaps within diis area. The collection 
of single specimens from Piney Creek and 
Rush Creek may indicate the fish were re- 
cently flushed from a cave system, as thev 
were collected in die spring. 

Burbot 

Lota lota (Linnaeus) 

Photo record (1; ca. 575 mm TL), Ohio Riv- 
er (Mississippi River), at RM 915. near Birds- 
viUe, Livingston Co., 5 Jun 2002. 

Remarks: In addition to the above record, 
which was verified bv a photograph supplied 
to us by Paul Rister (KDFWR), two additional 
records from the Ohio River are from 1993. 
One was an ca. 610 mm TL specimen from 
RM 630, at West Point, Jefferson Co., Ken- 
tucky, identified by Benjv Kinman (KDFWR). 
The second specimen, ca. 600 mm TL, was 
from RM 443. below Meldahl Dam in Brack- 
en Co., Kentucky. Identification of this speci- 
men was confirmed from a photograph ex- 
amined by LEK. Lota lota is fisted as "special 
concern" in Kentucky (KSNPC 2000) due to 
its general rareness and the uncertainty of its 
status. This species infrequently has been tak- 
en in the Ohio River and other large rivers of 
the state ( Burr and Warren 1986; Pearson and 
Pearson 1989). To our knowledge die 1993 
and 2002 records are the only ones in the state 



since 1983. Older records include a specimen 
from Louisville (Jordan L875 . and eight spec- 
imens from the Ohio, Kentucky, and Licking 
rivers collected between 1953 and 1967 (Clay 
1975). The origin of Kentucky specimens has 
been suggested to be escapees from stockings 
of private fishing lakes, waifs from more 
northern populations via the Missouri and 
Mississippi rivers, or a remnant, naturally re- 
producing population (Clav 1975; Trautman 
1981). The 1875 record is prior to widespread 
stocking efforts, and we are unaware of anv 
recent public stocking of L. lota, although pri- 
vate stocking is possible. We tentatively regard 
the origin of diese recent specimens as from 
a native population but cannot determine 
whether thev are waifs from northern popu- 
lations or represent a remnant population in 
the Ohio River. Although reproduction of L. 
lota in the Ohio River basin has not been doc- 
umented, dispersal from northern populations 
through numerous locks and dams to die up- 
per Ohio River would be difficult. 

Bluntnose Darter 
Etheostoma chlorosoma (Hay) 

SIUC 51069 (1; 37 mm SL). Sixes Creek 
(Indian Camp Creek), 0.5 km above Arnold- 
Baizetown Road, Ohio Co., 9 May 2002. 

Remarks: Etheostoma chlorosoma is occa- 
sional to locally common in streams of the 
Coastal Plain and the Tradewater River drain- 
age in the Shawnee Hills (Burr and Warren 
1986). However, only two prior records are 
known from the lower Green River drainage, 
Canev Creek, Gravson Co. and Long Pond. 
Hopkins Co. (Retzer et al. 1983; Burr and 
Warren 1986). The persistence of die Long 
Pond population has been verified with the 
collection of several individuals in 1997, two 
specimens vouchered (SIUC 40064). and two 
specimens collected on 17 Aug 1999. The Ca- 
ney Creek population represented the most 
upstream location until our collection from 
Sixes Creek, which extends the range ca. 105 
km upstream in the Green River drainage. 

Sixes Creek is a small, low-gradient tribu- 
tary of Indian Camp Creek located in die Cas- 
evyille Hills subecoregion (Woods et al. 2002). 
The specimen was taken in swift water among 
gravel, silt, and clav substrate. KDOW person- 
nel have conducted numerous stream surveys 



Distributional Records — Compton et al. 



SI 



in the lower (ween River drainage and found 
no additional E. chlorosoma populations. The 
speeies may have been more common in the 
lower Green River drainage but extensive ag- 
ricultural and mining practices probably have 
limited the speeies to a tew relatively undis- 
turbed streams in the Interior River Valley and 
Hills Ecoregion. 

Fringed Darter 

Etheostoma crossopterum Braasch and Max- 
den 

SIUC 26374 (4; 41-59 mm SL), Spring 
Creek (Obey River), KY 127 bridge, Clinton 
Co., 21 May 1996; SIUC 51095 (9; 26-51 mm 
SL), Spring Creek (Obev River), 0.2 km up- 
stream of KY 127, Clinton Co., 1 Nov 1999; 
INHS 57377 (15; 35-71 mm SL) Smidi Creek 
(Spring Creek), Concord Church Road, 1 May 
2000. " 

Remarks: Ethcostoma crossopterum, a 
member of the subgenus Catonotus, E. 
squamiceps complex, is locallv common in the 
lower Cumberland River in Kentuckv (Burr 
and Warren 1986). Our records are the first 
for die species from the Eastern Highland 
Rim in Kentuckv. These records, along with 
the record shown in Etnier and Starnes 
(1993). represent disjunct populations in die 
Obev River system. Ethcostoma crossopterum 
is found predominantly in die Western High- 
land Rim and Nashville Basin physiographic 
provinces of Tennessee and Kentuckv below 
the Caney Fork River system (Burr and War- 
ren 1986; Etnier and Starnes 1993). Existing 
and disjunct populations of E. crossopterum 
are divided bv a sister speeies, E. olivaceum, 
inhabiting the Caney Fork River system and 
adjacent tributaries of the Cumberland River. 
The two species are sympatric in the Cum- 
berland River tributaries immediately down- 
stream of the Caney Fork River confluence 
but are not s\ntopic (Etnier and Starnes 
1993). 

The geographically isolated Ethcostoma 
crossopterum populations in the Obev River 
system are of possible interest to systematists. 
Members of the subgenus Catonotus. because 
ol their fidelity to roekv headwater streams, 
exhibit considerable geographic variation and 
relatively high rates of speeiation (Page and 



Schemske L978; Page el al. 1992: Page et al. 

2003'. The SIUC (26374) and [NHS 57377 
collections had 1 and 10 breeding male spec- 
imens, respectively which allowed us to dis- 
tinguish them from other similar species. In 
addition, the specimens were taken from slab 
boulder/cobble habitat over fractured-bedrock 
in swift water. 

Johnnv Darter 

Ethcostoma nigrum Rafinesque 

MOSU 1830 (1; 42 mm SL), Unnamed trib- 
utary to Fishing Creek (Fishing Creek), in Sul- 
phur Springs Hollow, 0.7 km E of Cumber- 
land Parkway Bridge over Fishing Creek, Pu- 
laski Co., 23 May 2002. 

Remarks: Etheostoma nigrum is widely dis- 
tributed oxer much of Kentucky, but it is near- 
ly absent from the Cumberland River drainage 
(Burr and Warren 1986). The closely related 
and endangered (KSNPC 2000) Etheostoma 
susanae (Cumberland darter) is present above 
Cumberland Falls and was formerly treated as 
a subspecies of E. nigrum (Strange 1998). 
Some specimens from Poor Fork of die Cum- 
berland River (upper Cumberland River 
drainage) are morphologically intermediate 
between E. nigrum and E. susanae (Krotzer 
1990) and apparendy have an origin \ia stream 
capture from die headwaters of die Kentucky 
River (Strange 1998). Our collection of E. ni- 
gmm is onlv die second specimen collected 
from die middle Cumberland River drainage; 
the first (EKU 69) was collected in die Rock- 
castle River system (Starnes and Starnes 
1979). Moi-phologv of die Fishing Creek spec- 
imen is consistent with "tvpical" E. nigrum. 
Considering die limited Cumberland distri- 
bution of this headwater species, a stream cap- 
ture origin for die middle Cumberland pop- 
ulations seems likelv. 

Duskxtail Darter 

Ethcostoma pcrcnurum Jenkins 

SIUC 46940 (1; 41 mm SL), South Fork 
Cumberland River (Cumberland River). Blue 
Heron at canoe access. McCrearv Co.. 20 Sep 
2000. 

Remarks: Ethcostoma pcrcnurum. a feder- 
ally endangered speeies (Biggins 1993). was 
recently reported from the South Fork Cum- 



82 



il of the Kentucky Academy of Science 65(2) 



berland River in Kentucky (Eisenhour and 
Burr 2000). Etheostoma percnurum was found 
from the Tennessee border downstream ca. 8 
km to Bear Creek with the most abundant 
populations (although still relatively small) lo- 
cated within a 3-km reach from Oil Well 
Branch to 1 km upstream of Troublesome 
Creek (Eisenhour and Burr 2000). The record 
reported herein extends the range ca. 8 km, 
from Bear Creek downstream to Blue Heron. 
However, below Oil Well Branch onlv two 
specimens have been collected. Within this 
area there is limited pool habitat that is rela- 
tivelv silt-free and die river below Blue Heron 
is impounded, which creates unsuitable habi- 
tat for E. percnurum. 

The National Park Sendee in Big South 
Fork National River and Recreation Area 
protects the South Fork Cumberland River; 
however, the legacy of mining activities and 
other anthropogenic activities in die water- 
shed continues to be a threat to the aquatic 
biota and stream integritv. For instance, Ei- 
senhour and Burr (2000) observed "extreme- 
ly turbid water" discharging from Bear Creek 
following a rain event, and McMurrav and 
Schuster (2001) found diat the aquatic mac- 
roinvertebrate and fish communities of Bear 
Creek remained severely impaired following 
initial reclamation efforts. Therefore, E. perc- 
nurum will most likely continue to remain 
rare below Oil Well Branch because of mar- 
ginal habitat and historical anthropogenic ac- 
tivities. 

DISCUSSION 

Although large rivers have been severely al- 
tered bv urban sprawl, mining operations, ag- 
ricultural practices, and construction of dams, 
which affect die dispersal of its inhabitants, 
the collections of Ichthyomyzon unicuspis, 
Acipenser fulvescens, Scaphirhynchus plato- 
njnehus, and Lota lota indicate that monitor- 
ing of large rivers is necessary to update and 
define the range and conservation status of a 
species. In addition, monitoring of smaller sys- 
tems is important in documenting new drain- 
age records (e.g., Phoxinus oreas and Forbes- 
ichthys agassizii) and range expansions (e.g., 
Etheostoma crossopterum and Etheostoma ni- 
grum) and in establishing data for long-term 
trend monitoring. Also, the number of records 



brought to our attention by commercial fish- 
ermen and recreational anglers underscores 
the importance of communication between 
these individuals and the scientific community. 
This information provides resource managers 
with current and credible data in their efforts 
to conserve and protect species and their 
aquatic habitats. This is especially important 
in Kentucky because the state does not have 
any state-endangered or threatened species 
laws. Therefore, protection of species, except 
for the federally endangered Etheostoma perc- 
nurum, is minimal. 

ACKNOWLEDGMENTS 

We thank current and former KDOW per- 
sonnel J. Brumley, S. Call, E. Eisiminger, S. 
McMurrav, L. Metzmeier, D. Mover, R. 
Pierce, G. Pond, and M. Vogel; former 
KSNPC personnel T Hagman and J. Johan- 
sen; K. McCafferty (MOSU) and L. Eisen- 
hour for their assistance in the field; current 
and former SIUC personnel B. Burr, D. Hen- 
ry, D. Shasteen, J. Stewart, M. Thomas, and 
D. Zeman; current and former KDFWR per- 
sonnel W. Davis, D. Hale, D. Henlev, B. Kin- 
man, K. Osborne, K. Prather, and P. Rister; 
B. Fisher (IDNR), J. Clark (T.H.E. Engi- 
neers, Inc.), M. Kenawell (T.H.E. Engineers, 
Inc.), M. Horsley, and R. Russell for sharing 
collection information for several species; M. 
Retzer (INHS) and J. Stewart (SIUC) for the 
length measurements of several specimens; 
and B. Burr for sharing his expertise on sev- 
eral of the species reported, confirmation of 
the identification of A. fulvescens from pho- 
tographs, and his life-long dedication to 
freshwater fishes. 

LITERATURE CITED 

Biggins, R. E. 1993. Endangered wildlife and plants: de- 
termination of endangered status for the duskytail dart- 
er, palezone shiner and pygmy madtom. Fed. Register 
58:25758-25763. 

Burr, B. M., and M. L. Warren, Jr. 1986. A distributional 
adas of Kentucky fishes. Kentucky Nature Preserves 
Comm. Sci. Techn. Ser. 4:1-398. 

Burr, B. M., M. L. Warren, Jr., G. K. Weddle, and R. R. 
Cicerello. 1990. Records of nine endangered, threat- 
ened, or rare Kentucky fishes. J. Kentucky Acad. Sci. 
51:188-190. 

Ceas, P. A., and L. M. Page. 1997. Systematic studies of 
the Etheostoma spectabile complex (Percidae; Subgenus 



Distributional Records — Compton et <d. 



83 



Oligocephalus), with description ol four new species. 
Copeia 1997:496-522. 
Cicerello, R. R., and E. Laudermilk. 1996. Rediscovery of 

Ammoin/plii clarti I Percidae) in Koiituckx: range exten- 
sions for six other Kentucky fishes. J. Kentucky Acad. 
Sei. 57:126-127. 

Clay, W. M. 1975. The fishes of Kentucky. Kentucky De- 
partment of Fish and Wildlife Resources, Frankfort, 
KY. 

Eisenhour, D. J., and B. M. Burr. 2000. Conservation sta- 
tus and nesting biology of the endangered dnskytail 
darter. Etheostoma percnurum, in the Big South Fork 
of the Cumberland River, Kentucky. J. Kentucky Acad. 
Sei. 61:67-76. 

Etnier, D. A., and W. C. Stames. 1993. The fishes of Ten- 
nessee. Univ. Tennessee Press, Knoxville, TN. 

Hocutt, C. H.. R. E. Jenkins, and J. R. Stauffer, Jr. 1986. 
Zoogeography of fishes of tire central Appalachians and 
central Atlantic Coastal Plain. Pages 161-211 in C. H. 
Hocutt and E. O. Wiley (eds). The zoogeography of 
North American freshwater fishes. John Wiley and 
Sons, New York, NY. 

Hubbs, C. L., and M. B. Trautman. 1937. A revision of 
the lamprey genus Ichthyomyzon. Univ. Michigan Mus. 
Zool. Misc! Publ. 35:1-109. 

Jenkins, R. E., and N. M. Burkhead. 1993. Freshwater 
fishes of Virginia. American Fisheries Society-, Bethesda, 
MD. 

Jordan. D. S. 1S75. Synopsis of the genera of fishes to be 
looked for in Indiana. Annual Rep. Geol. Surv. Indiana 
1874:197-228. 

Komman, L. 1995. New records of slender madtom, No- 
turus exilis Nelson, South Fork Licking River, Pendle- 
ton County, Kentucky. Trans. Kentucky Acad. Sei. 56: 
57. 

Krotzer, M. J. 1990. Variation and systematics of Etheos- 
toma nigrum Rafinesque, the johnny darter (Pisces: 
Percidae). Ph.D. Dissertation. Univ. Tennessee, Knox- 
ville. TN. 

[KSNPC] Kentucky- State Nature Preserves Commission. 
2000. Rare and extirpated biota of Kentucky-. J. Ken- 
tucky Acad. Sei. 61:115-132. 

Lachner, E. A., and R. E. Jenkins. 1971. Systematics, dis- 
tribution, and evolution of the Nocomis higuttatus spe- 
cies group (Family Cyprinidae: Pisces) with a descrip- 
tion of a new species from the Ozark upland. Smith- 
sonian Contrib. Zool. 91:1-28. 

Lawson. L. H. 2003. The crayfishes (Decapoda: Canibar- 
idae) of the Green River basin, Kentucky. M.S. Thesis. 
Eastern Kentucky Univ., Richmond. KY'. 

Mc.Murrav. S. E.. and G. A. Schuster. 2001. Macroinver- 
tebrate, fish, and physiochemical differences between 
an acid mine impacted stream and a Kentucky Wild and 
Scenic River. J. Kentucky Acad. Sei. 62:125-141. 

Nelson. |. S., E. J. Grossman. II. Espinosa-Perez. 1.. T. 
Findlev. C. R. Gilbert, R. N. Lea, and J. D. Williams. 
200-1. Common and scientific names ol lislies from the 



United Stales. Canada, and Mexico, 6th cil. American 

Fisheries Society, Bethesda, Ml) 

Page. L. M„ P. A. Ceas, D. L. Swofford, and D. G. Ruth. 
1992. Evolutionary relationships within the Etheostoma 
squamiceps complex (Percidae: Subgenus CatonotUi 
with description ol five new species, Copeia 1992:615- 
646. 

Page, L. M., M. Ilardman. and T. J. Near. 2003. Phylo- 
genetic relationships of barcheck darters (Percidae: 
Subgenus Catonotus) with description of two new spe- 
cies. Copeia 2003:512-530. 

Page, L. M., and D. W. Schemske. 1978. The effect of 
interspecific competition on the distribution and size of 
darters of the subgenus Catonotus (Percidae: Etheos- 
toma). Copeia 1978:406-412. 

Pearson, W. D.. and B. J. Pearson. 1989. Fishes of the 
Ohio River. Ohio J. Sei. 89:181-187. 

Powers, S. L., and P. A. Ceas. 2000. Ichthyofauna and 
biogeography of Russell Fork (Big Sandy-Ohio River). 
Southeast. Fishes Council Proc. 41:1-12. 

Retzer, M. E., B. M. Burr, and M. L. Warren, Jr. 1983. 
Fishes of the lower Green River drainage. Kentucky. 
Kentucky Nature Preserves Comm. Sei. Techn. Ser. 3: 
1-18. 

Ryon, M. C... and B. A. Carrico. 1998. Distributional re- 
cords for fishes of the Coastal Plain Proxince. Ballard 
and McCracken counties, in western Kentucky. J. Ken- 
tucky Acad. Sei. 59:51-63. 

Sisk, M. E. 1969. The fishes of west Kentucky. I. Fishes 
of Clark's River. Trans. Kentucky Acad. Sei. 30:54-59. 

Stames, W. O, and L. B. Stames. 1979. Taxonomic status 
of the percid fish Etheostoma nigrum susanae. Copeia 
1979:426-430. 

Strange, R. M. 1998. Mitochondrial DNA xariation in 
johnny darters (Pisces: Percidae) from eastern Ken- 
tucky supports stream capture for the origin of Upper 
Cumberland Rix'er fishes. Am. Midi. Naturalist 140:96- 
102. 

Trautman, M. B. 1981. The fishes of Ohio with illustrated 
keys, rexised ed. Ohio State Unix-. Press, Columbus. 
OH. 

van Winkle, W. P. J. Anders. D. II. Secor, and D. A. 
Dixon, eds. 2002. Biology, management, and protection 
of North American sturgeon. Am. Fish. Soc. Sxnnp. 2S: 
1-274. 

Warren, M. L., Jr. 1981. New distributional records for 
eastern Kentucky fishes. Brimleyana 6:129-140. 

Warren, M. L., Jr.. and R. R. Cicerello. 1983. Drainage 
records and conservation status evaluations tor thirteen 
Kentucky- fishes. Brimleyana 9:97-109. 

Warren, M. L.. R. R. Cicerello, C. A. Taylor, E. Lauder- 
milk, and B. M. Burr. 1991. Ichthyofaunal records and 
range extensions for the Barren. Cumberland, and Ten- 
nessee river drainages. J. Kentucky Acad. Sei. 52:17-20. 

Welter, W. A. L938. A list of the fishes of the Licking River 
drainage in eastern Kentucky Copeia I93S-ISI (is 

Wood. R. M . R. L. Mavden. R. II Matson, B R kn 
hajda, and S. R. Layman. 2002. Systematics and bio- 



84 Journal of the Kentucky Academy of Science 65(2) 

geography of the Notropis rubellus species group (Te- map, descriptive text, summary tables, and photo- 

leostei: Cyprinidae). Bull. Alabama Mus. Nat. Hist. 22: graphs). Reston, VA, United States Geological Surve) 

37-80. (map scale 1:1,000,000). 

Woods, A. J., J. M. Omernik, W. H. Martin, G. J. Pond, Woolman, A. J. 1892. Report of an examination of the 

W. M. Andrews, S. M. Call, J. A. Comstock, and D. D. rivers of Kentucky, with lists of the fishes obtained. Bull. 

Taylor. 2002. Ecoregions of Kentucky (color poster with U.S. Fish Comm. 10:249-288. 



J. Ky. Acad. Sci 65(2 :85 93. 2004. 

Developing a Fast LDA Calculation to Model Group III 

Nitride Crystals 

G. Yoder 

Department of Physics and Astronomy, Eastern Kentucky University, Richmond, Kentucky 10175 

ABSTRACT 
A last, semi-empirical computational method lias been developed to model Croup Ill-Nitride semi-con- 
ductor crystals. The calculation is based on an LDA approach with reduced range, local orbitals in the Harris 
approximation. Small tight-binding-like corrections are used to allow the calculation to produce quantitative 
lattice parameters and band gaps. This allows run-time to be substantially less than more rigorous LDA 
calculations. Preliminary results on small supereells are shown to agree well with (lie more rigorous calcu- 
lations and experimental data. 



INTRODUCTION 

This work is focused on studying Group III 
Nitride (III-N) semiconducting crystals and 
their allows using a fast Local Density Approx- 
imation (LDA) method. The nitrides have very 
wide band gaps and are very strong materials, 
which make ideal candidates for a wide range 
of device applications. These applications in- 
clude ultraviolet (UV) and blue semiconductor 
lasers and detectors, high temperature and ra- 
diation resistance electronics, high frequency 
and low-noise communication devices, high- 
power radar and microwave devices. 

Many of the structural and electronic prop- 
erties of these III-N crystals have been well 
documented (Lambrect and Segall 1994; Mor- 
koc et al. 1994; Schilfgaarde et al. 1997; Strite 
and Morkoc 1992). However, in part because 
die very short bond lengdis of the nitrides 
make suitable substrates hard to find, these 
materials have been notoriously difficult to 
grow. Although techniques are improving all 
the time, crystals tend to be heavily n-type as 
grown. This phenomenon is usually attributed 
to nitrogen vacancies. Thus, p-doped nitrides 
are very difficult to make. In 1997, blue LEDs 
and laser diodes were achieved using GaN 
(Nakamura et al. 1997). The troublesome p- 
doping of GaN was done with Mg but re- 
quired a very high concentration of the dopant 
to get acceptable hole concentration. One rea- 
son for this is that the acceptor level created 
by the Mg doping is quite deep. Another rea- 
son the high Mg concentration is necessary is 
that nitrogen vacancies and hydrogen impuri- 
ties that are unintentionallv present in (AD 
grown crystals compensate the Mg-acceptors. 



The acceptor states need to be reactivated af- 
ter growth with either low-energy electron- 
beam irradiation or thermal annealing (Amano 
et al. 1989; Nakamura et al. 1992). The role 
of the H impurities in compensating the ac- 
ceptor states has been explained by a careful 
analysis of the process using a rigorous LDA 
method (Neugebauer and Van de Walle 1996). 
Other dopants, like Cd, Hg, and Ca, have even 
deeper acceptor levels and would require even 
higher dopant concentrations. 

The problem of p-doping tends to increase 
with the band gap as well. As the band gap 
widens both donor and acceptor levels tend to 
deepen, making doping more difficult. For ex- 
ample, it was found when GaN and AlN were 
alloyed (Ga^Al^N) the electrical receptivity in 
unintentionally doped samples increased rap- 
idly' as die Al concentration increased. This 
makes the development of UV LEDs and laser 
diodes much more difficult. 

Clearly, LDA has made remarkable contri- 
butions in studying the energetics and defect 
structures involved with III-N semiconductors 
and their doping. However, alloying and dop- 
ing require large supereells in order to get a 
meaningful result. The fully self-consistent 
LDA calculations are too time-consuming to 
be used in this respect. A more efficient meth- 
od is needed to provide results for large-scale 
calculations. 

The method in this work takes an LDA cal- 
culation based on local orbitals in the Harris 
approximation that has been recently devel- 
oped at Auburn University, which has been 
able lo accurately predict bond lengths and 
bulk moduli ol many 111-Y and 11-Y1 semicon- 



85 



SI, 



Journal ol the Kentucky Academy ol Science 65(2) 



ducting compounds in short times, including 
the pure III-N crystals (Dickerson 1997). Also 
the electronic structure calculated from this 
method has all the qualitative features of oth- 
er, more rigorous, methods. Including a small 
correction to the ah initio LDA. allows the cal- 
culation to produce the basic quantitative 
bandstraeture. The crystal structure is then 
fitted to die experimental lattice parameters 
with a simple addition of a small repulsive 
term to the total energy. With this correction, 
the model is applied to supercells to examine 
how the bandstmcture changes with die ad- 
dition of native defects. 

This paper will discuss the LDA method 
used, the empirical correction employed to 
generate quantitative bandstructure, the re- 
sults of this calculatation and the wide range 
of possibilities that can be actualized using this 
method. 

COMPUTATIONAL METHOD 

The object of designing the ab initio LDA 
calculation was to make it fast enough to han- 
dle supercells of 100 atoms or more. To do 
this a number of approximations needed to be 
made. In this section, the three most critical 
choices that were made to implement this fast 
calculation will be discussed. 

The first choice was to use localized orbitals 
as our basis of calculation. Local orbitals are 
not orthogonal and there are no intrinsic pa- 
rameters to control die convergence of the set 
as there are with plane waves. However, far 
fewer local orbitals are needed to produce 
converged results, which reduces run-time 
considerably. There has been considerable 
success for predicting the properties of III-V 
and II-VI semiconductor crystals using only- 
one s-orbital and three p-orbitals per atom 
(Dickerson 1997). Local defects such as va- 
cancies and impurities also produce local 
states that plane waves would straggle with. 
Also, local orbitals make the calculation more 
flexible. That is, they can be used in a wide 
variety of materials that are not fully periodic. 



e.g.. single alums, molecules, polymers, nano- 
tubes, etc. Again, these are systems that are 
inherently difficult for plane waves to handle. 
Specifically minimal sets of compact orbit- 
als we developed based on atomic orbitals. 
The atomic orbitals are determined bv apply- 
ing a fully self-consistent LDA calculation to 
the single atom problem using a robust gaus- 
sian basis set. The range of these atomic or- 
bitals can then be reduced similar to the ap- 
proach of Sankey and Niklewsla (19S9). Un- 
like Sankey, the orbital is not simply truncated; 
it is required that die orbital and its derivative 
remain continuous at all radii. The atomic or- 
bital is fitted exacdy inside a cutoff radius after 
which the orbital decays very quickly In semi- 
conducting crystals diese compact orbitals 
produce converged results when interactions 
onlv up to third or fourth neighbor are includ- 
ed. In order to facilitate calculation these or- 
bitals are expanded in a linear combination of 
gaussian functions and renormalized to pro- 
duce a neutral atom. The orbitals used in this 
work are shown in Figure 1. The linear com- 
bination of Gaussian used to generate diese 
functions are specified in Table 1, widi A, and 
a being die coefficients and decay constants 
of the expansion as determined in die equa- 
tion: 



(1) 



<D,(r) = 2>,.| — \ e -«,r°- 



These radial functions are dien multiplied 
by die real spherical harmonics to get the 
complete orbital. 

The second choice made to reduce run- 
time is the use of a pseudopotential so that 
die core electrons do not have to be treated 
explicitly The pseudopotential is designed to 
reproduce die wave function and density of 
the full potential exacdv outside a certain ra- 
dius from the atom. This calculations uses die 
pseudopotential developed by Hamman, 
Schulter, and Chiang (1979). For GaN and 
InN it was necessary to treat die d electrons 



Figure 1. Orbitals used in LDA Calculation. The atomic orbital is the dashed line; the solid line is die reduced-range 
orbital used in this work. The reduced-range orbital is renormalized to produce a neutral atom. They are shown here 
unrenormalized to compare the shape and range of die reduced-range orbitals to the atomic orbitals. The horizontal 
axes are in Bohr radii (a„). The vertical axes use units of a,," 1 ' 2 for the s orbital and a^ 1 - for the p orbital. 



LDA Calculation — Yoder 



s: 



ALUMINUM 





BORON 





GALLIUM 





INDIUM 





NITROGEN 





ss 



fourna] ol the Kent i itk\ Academy ol Science 65 2 



Table 1. Orbitals used for LDA Calculation. The coefficients and deca) constants for atomic orbitals defin 
equation (1) are listed below. The a,'s are in units of a,, ' and A,'s are in units of a^ ; . 









) 


i 




i 




" 


.\ 


a, 


A. 


°. 


". 


B 
i 














1 


0.2115 


0.7700 


0.3105 


0.7274 






2 


0.6777 


0.2615 


0.6230 


-0.5936 






3 


1.9385 


-0.9191 


1.1540 


1.2588 






4 


.5.4724 


0.4757 


2.1625 


-0.0020 






5 


15.3507 


-0.2239 


4.1663 


0.7533 






N 














1 


0.5382 


-4.3934 


0.3917 


0,5512 






2 


0.8377 


8.4704 


0.8373 


0.4601 






3 


1.3250 


-10.2842 


1.9694 


1.5532 






4 


2.1410 


6.3572 


4.7858 


2.0949 






5 


3.5170 


-0.9203 


11.8171 


1.4368 






Al 
i 














1 


0.2020 


-1.2501 


0.2184 


-0.5284 






2 


0.4548 


1.294.3 


0.4720 


0.3872 






3 


0.8910 


-0.7715 


0.9742 


-0.4479 






4 


1.6709 


1.1736 


1.9757 


0.6019 






5 


3.0719 


-0.9092 


3.9768 


-0.7207 






6 


5.5922 


0.3445 


7.9776 


0.7320 






7 


10.1273 


-0.0532 


15.9776 


-0.4556 






Ga 
i 














1 


0.1615 


-0.7517 


0.1916 


0.6490 


0.2198 


-0.0378 


2 


0,5191 


0.2330 


0.3250 


-1.1594 


0.2801 


0.1042 


3 


1.5350 


0.6502 


0,5170 


1.7919 


1.3568 


2.0812 


4 


4.3605 


-0.3837 


0.8012 


-1.5096 


4.5796 


17.8218 


5 


12.2633 


0.1409 


1.2234 


0.5238 


11.1092 


35.6777 


6 










29.1552 


-46.3553 


In 
i 














1 


0.1763 


-0.9939 


0.1145 


0.1847 


0.1617 


-0.0058 


2 


0.3810 


0.3646 


0.2S15 


0.0557 


0,5291 


-0,3409 


3 


0.7856 


0.9248 


0,5738 


-0.0496 


1.4766 


-2.7556 


4 


1.5898 


-0.4106 


1.0953 


-0.1288 


3.9508 


-6.9840 


5 


3.1898 


0.0475 


2.0305 


0.1580 


10.6424 


7.9237 


6 






3.7118 


-0.1109 


28.7114 


-7.2654 


7 






6.7351 


0.0405 







of Ga and In explicitly, since diese states in- 
teract strongly with the deep 2s electrons in 
N. So a new pseudo-potential was developed 
using the same mediods as Hamman et al. to 
handle these interactions. The new pseudo- 
potential, with the inclusion of the "semi-core" 
d-electrons, improved the prediction of die 
bond lengths from 7.4% error to 3.0% error 
in zb GaN with similar improvement for InN. 
The diird choice was to use die Harris Ap- 
proximation (Harris 1985), which allows a 



number of different procedures to be imple- 
mented. The electron density of the crystal is 
chosen to be die linear combination of the 
atomic densities. This means that each atom 
remains neutral during the entire calculation, 
which, in turn, means die potential is short- 
ranged. The attractive core term and die re- 
pulsive Coulomb term cancel one another at 
large distances from the atom. These two po- 
tentials are combined and treated as a single 
potential, which is easily fitted to linear com- 



1 .1 ) \ ( lalculation — Yoder 



S9 



Tabic- 2. Equilibrium Crystal Structure of Nitrides using tlir fast I. DA Method. Experimental results Lambrecl .cud 
Segall, 1994) arc shown in parentheses. The lattice constant, a, is listed in Angstroms. Structural parameters e/a and u 
arc the commonly defined imilless ratios lor wz. 



Compound 


Crystal structure 


" 


. onl) 


u wz onh 


BN 


zb 


3.653 (3.616) 


— 


— 




wz 


2.575 


1.649 


0.3742 


AIN 


/.I) 


4.19S (4.369) 


— 


— 




wz 


2.985 (3.111) 


1.6(10 11.600) 


0.382 (0.385 


GaN 


zb 


4.367 (4.501) 


— 


— 




wz 


3.087 (3.180) 


1.629 (1.624 


0.376 (0.375 


InN 


zb 


t.912 4.97) 


— 


— 




wz 


3.473 (3.533) 


1.633 (1.6111 


0.375 (0.375- 



biaation of gaussian functions. This allows for 
rapid, analytic evaluation of matrix elements, 
since the orbitals are also linear combinations 
of gaussians. Since this potential is linear in 
the density these matrix elements can then be 
stored in large arravs. The matrix element 
needed at run-time is then simply interpolated 
from this table. 

Only die exchange-correlation term resists 
tabulation and analytic treatment due to the 
fact diat it is not a linear function of density. 
To treat this term we fit the exchange-corre- 
lation potential to a linear combination of 
gaussian functions in the same manner as die 
Coulomb-core term. However, unlike the 
Coulomb term, die fit must be done at run- 
time. Due to the complicated form of die ex- 
change, the fit is imperfect but results in a 
very reasonable approximation of this poten- 
tial'. 

Using the local orbitals and the single cal- 
culation of the matrix elements in the Harris 
approximation, the calculation has the form of 
an ab initio tight-binding (TB) calculation. As 
such, it provides a useful way to conceptualize 
the interactions taking place in the crystal. The 
calculation has been used as the foundation of 
a semi-empirical model for die ground-state 
molecular structure and quantitative band 
structure for organic polymers. This model has 
shown itself to be a \*erv durable and trans- 
ferable method for calculating band gaps and 
bond lengths of many different types of con- 
jugated, organic polymers (Yoder et al. 1999). 
This was possible because it has all the char- 
acteristics of a TB calculation but avoids the 
tedious fitting of a large number ol parameters 
to experimental results that is found in purely 
empirical models. 

This method has also proven itseli to be a 



good method to produce structural properties 
of III-Y and Il-YI semiconductors. Bond 
lengths are generally within 2% of experimen- 
tal values, and bulk moduli are within 10% 
(Dickerson 1997; Yoder et al. 1999). These re- 
sults compare favorably to other slower, more 
rigorous LDA methods. 

For the III-N crystals in this work, the re- 
sults of this method using the orbitals defined 
b\ Table 1 are shown in Table 2. Also the band 
structure of the crystal can be extracted from 
die electron states produced by the calcula- 
tion. The band structure produced by this cal- 
culation is qualitatively the same as the band 
structures that were calculated with a full-po- 
tential, self-consistent LMTO LDA calculation 
done bv Lambrecht and Segall (Lambrecht 
and Segall 1994). This comparison is made in 
Figure 2 for zb-AlN and wz-GaN. Besults for 
the other nitrides are similarly consistent with 
the more rigorous calculations. 

EMPIRICAL CORRECTION 

To make this method quantitative we have 
included small correction terms (much like a 
TB model) that we can fix to experimental 
band gaps and lattice parameters. Specifically 
all that is needed to get the correct band gaps 
of the material is to shift the cation on-site s- 
states up to increase the size of the band gap 
at the experimental lattice parameters. Only in 
BN does the correction need to be applied to 
all the on-site B matrix elements, as the B s- 
and p-states are strongly intertwined for this 
crystal (Lambrect and Segall 1994). Also, the 
correction for BN reduces rather than increas- 
es the size of the band gap as tin- Harris LDA 
tends to calculate a band <j;ap that is too large'. 
The size of the corrections needed to produce 
the correct <j;ap in each of these crystals is 



90 



Journal of the Kentucky Academy of Science 65(2) 



14- 


f 


'v 


— >^ 




^L 


--/ 


















12- 


12 i 
















10- 


/ 







N 


<£- 




10 - 
















8- 


-C-_-^ 




\ 


/^- 


^v/ 




8 - 
















6- 














6 - 
4 - 
















4- 








2- 














2 -i 
















0- 














- 
















-2- 














-2 - 
















-4- 














-4 - 
















-b- 


■^^ 




s7" 


— 7" 


^\\ 




-6 J 
















-8- 


K 


~^= 


// 


/ 


\v 


^ 


-8 - 
-10 - 
















-10- 






-12- 






^ — 


y 






-12 - 
















14- 














-14 - 


















— -"*"" 




-1b 

-1R- 














-16 - 
-18 - 
-20 - 




























yj 












-22- 














-22 - 































X W L r K X 



M K 



H K 



14 


sC\ /* 










S=L 








3 /"T^ 






12 










15 N; — ' 


- 


10 








i 




\- 


8 


— 3 










- 


6 


— /~\ 






\. 




— 


4 


\ 








1 


s 


2 












— 




-"\^--^ 5 






3 


15 








^ST*\ 


-2 


- \ 








V\ 


> 


-4 


- \. 








\\, 


VI 


-6 


_ ; 






1 




- 


-8 












- 


-10 


i 










- 


-1? 








1 
















-14 










\^/ 


- 


-IB 















X W L r K X 



12 




^yC&^j 


5p-<5 








- 


10 


- 




--\ i 










8 
6 


— f 




3 \ — 


3 






^ 


4 
2 


— 




3/ 








— 









1 


4 






- 


-2 


_i\ 


^r/jy 


Wk\ 








-v- 


-4 


"™**V; 






1 






/- 


-8 


_ 


i \^_ 


3 


l"~^ 






_ 


10 














- 


12 


^ 




3 ■ - 


^T 






- 


14 






1 


i 






- 


16 




! "~^^^ 




3 






- 



M K 



M L 



H K 



(a) zb-AIN 



(b) wz-GaN 



Figure 2. Basic Band Structure of Nitrides, (a) The left column is the band structure of zinc-blend AlN calculated 
using the method of diis work (top) and calculated using a full-potential, self-consistent LDA method (bottom) (Lam- 
brect and Segall 1994). (b) The right column is die band structure of wurtzite GaN calculated using the mediod of 
this work (top) and calculated using a full-potential self-consistent LDA method [4] (bottom). 



shown in Table 3. Since this correction is only 
added to states in the valence band, it affects 
the total energy only indirectly. To produce 
the measured lattice parameters of the mate- 
rial a small (~1 eV per bond at equilibrium 
bond length) exponentially decaying term is 
added to the total energy. The parameters of 



this scalar correction are listed in Table 3 as 
well, where A and a represent the coefficients 
and decay constants in the equation: 

R(r) = Ae-" r (2) 

The final corrected results for these mate- 
rials, both in die zb and wz crystal structures, 



LDA Calculati 



-Yode 



91 



Tabic 3. Num erica] Parameters used for an Empirical 
Correction to U)A Calculation. 



sluit of on-site mntrto 


elements 




Element 






Shill (eV) 


B 






-0.403 (p-states) 


Al 






0.879 (s-states) 


Ga 






1 .256 (s-states) 


In 






1 .303 (s-slates) 


Panimcter Cor scalar i 


nerg) 


term defii 


rd in equation (2). 


Bond 




» i \ ' 


\ , \ 


B-N 




4.0 


1 1 1 1 


Al-N 




4.0 


373.35 


Gil-N 




4.0 


398.25 


In-N 




4.0 


87.01 



are listed in Table 4. Once we have corrected 
results for these materials we can apply this 
correct model to larger systems. We have ap- 
plied these results to small supercells (64 at- 
oms for zb, 72 for wz) just large enough to 
contain all third neighbors in the unit cell. An 
atom is then removed form the center of the 
supercell, and the first and second neighbors 
to the vacant site are allowed to relax. The first 
neighbors relax toward or away from die va- 
cant site; the second neighbors relax toward 
or away from die first neighbors. When diese 
sets of atoms relax, die band structure is re- 
calculated. The supercell bandstructures are 
shown in Figure 3 for zb crystals with a N- 
vacancy and with then with a cation vacancy. 
The perfect crystal bandstructures (first col- 
umn in Figure 3) are shown beside the vacan- 
cy bandstructures to illustrate how the elec- 
tron states change. Since removing a nitrogen 
atom causes an odd number of electrons to be 
removed, one of die bands shown is half-filled 
and can be considered the donor or acceptor 
state. This half-filled bands are indicated with 



arrows on the figure. In all cases, we see that 
for the N-vacancy, the half-filled band is in- 
tertwined with some of the conduction bands. 
This indicates thai it acts as a shallow donor. 
Although in the case of AlN several of the low- 
est conduction bands, including the half-filled 
band, have separated from the higher hands 
creating a small gap. Similarly, for the cation 
vacancy the half-filled band is the highest va- 
lence band and crosses the other filled bands. 
This suggests it acts as a shallow acceptor. 
These results are in good agreement with oth- 
er experiments and with other calculations. 

FUTURE WORK 

We have begun establishing a clear, quan- 
titative picture ot the pure materials that will 
allow us to then add a wide range of defects 
and impurities to the materials and determine 
defect energies and at least the qualitative be- 
havior of the donor/acceptor states these 
changes produce. The range of problems this 
method could dien be applied to would be 
very large and could be used in the laboratory 
to test ideas of dopants, dopant concentra- 
tions, and other factors to guide their pro- 
gress. Of particular interest is the p-doping of 
GaN, where a number of possibilities have 
been raised. It has been predicted that C on 
an N-site and Be on a Ga-site were better do- 
nors dian the Mg dopant that is currently be- 
ing used (Wang and Chen 2001). However, it 
has also been shown that Be energetically pre- 
fers an interstitial location over the Ga-site lo- 
cation (Van de Walle 1996). With our method, 
we should be able to confirm or contradict 
these findings and move toward finding a 
more efficient way to make p-t\pe GaN. With 
die large supercells that this method can ad- 



Table 4. Equilibrium Crystal Structure of Nitrides using the Modified LDA Method. Experimental results are shown 
in parentheses. The lattice constant, a, is listed in Angstroms. Structural parameters c/a and u are the commonl) defined 
unitless ratios for wz. Band gap is listed in eV. 



Coi upon nd 


Crystal structure 


■' 


c7a (wz link 


u (wz only) 


Band gap 


BN 


zb 


3.612 (3.616) 


— 


— 


6.1 (6.1) 




wz 


2.552 


1.646 


0.375 


7. SI 


AlN 


zb 


4.369 (4.369) 


— 


— 


6.03 




wz 


3.106 (3.111) 


1.601 (1.600) 


0.383 (0.385) 


6.20 6 1 


GaN 


zb 


1.503 (4.5011 


— 


— 


3.29 (3.3 




wz 


3.178 (3.180) 


1.6.35 (1.624) 


0.375 (0.375) 


! I" 3.5 


InN 


zb 


4.986 (4.97) 


— 


— 


1.76 




wz 


3.524 (3.533) 


1.633 (1.611) 


0.375 (0.375^ 


1.92 (1.9) 



92 



Journal of the Kentucky Academy oJ Science 65 2 
Perfect Crystal Nitrogen Vacancy Cation Vacancy 



BN 





AIN 





..-. 














GaN 




A A 


A 






A/ 


^ 


















\y \y 


V 
























InN 





Figure 3. Supercel] Bandstructure of Nitrides. Band structures produced with semi-empirical calculation for supercells 
of 64 atoms for the zinc-blend Ill-nitride crystals. The first column is the band structure of the pure crystal. The center 
column is the supercell wiUr a single nitrogen vacancv and the right column is the supercell with a single cation vacancy. 
The arrows in the last two columns indicate the positions of the highest occupied (half-filled) bands. 



I, DA Calculation— Yoder 



93 



dress, we can even perhaps model co-doping, 
calculate binding energy of donor-acceptor 
pairs, and study alloying of the materials in 
addition to doping. 

Other potential applications include the in- 
vestigation of the role of hydrogen in the dop- 
ing process and modeling the dopant profile 
across interfaces in heterostructures. The role 
of hydrogen has already been shown to be a 
key plaver in Mg doping of GaN as discussed 
earlier. Oxygen impurities are found to pro- 
duce "DX states" as they are allowed to relax 
in the crystal and are found in vvurtzite lattic- 
es, but not in zinc-blende lattices (Chen and 
Slier 1995). Again the existence and stability 
of these states are straight-forward results of 
this calculation. The dopant profiles across in- 
terfaces in heterostructures which are neces- 
sary for almost all device applications and re- 
quire large supercells, could also be studied. 
Understanding interfacial segregation is criti- 
cal to controlling doping in these devices. 

The potential application of this method is 
great and will contribute not only to practical 
device development but will also contribute to 
the fundamental understanding of basic semi- 
conductor physics. 

ACKNOWLEDGMENTS 

Thanks to Dr. An-Ban Chen of Auburn Uni- 
versity for useful discussions as well as Ken- 
tucky NSF EPSCoR for support of this work. 

LITERATURE CITED 

Amano. H„ M. Kito, K. Hiramatsu, and I. Akssalri. 19S9. 
P-type conduction in Mg-doped GaN treated with low- 
energy electron beam radiation (LEEBI). Japan. J. 
Appl. Phys. 28:L2112. 

Chen, A.-B., and A. Slier. 1995. Semiconductor alloys: 



j >1 in sits and in. iirriak engineering. Plenum Publishing 
New York. NY, 

Dickerson, B. K. 1997. Theon ol semiconductor alloys: 
molecular dynamics of disordered structures, Monte- 
Carlo simulations of phase diagrams, and efficient AB- 
initio energ) method. Ph.D. Thesis. Auburn University, 
Auburn. AL. 

I lam. inn. D. Pi., M. Seliluler. and C. Chiang. 1979. \orui- 
conserving pseudopotentials. Phys. Rev. Lett. 43:1494. 

I [arris, J. 19S5. Simplified method for calculating the en- 
ergy of weakh interacting fragments. Plivs. Rev. B 31: 
1770-1779. 

Lambrect, W. H. I... and B. Segall. 199-1. Pages 125-127 
in J. H. Edgar (ed). Properties of group III nitrides. 
EM IS Datareviews Series. London. 

Morkoc. H., S. Strife. G. B. Gao. M. E. Lin. B. Sverdlov. 
and M. Bums. 1994. Large-band-gap SiC. III-Y nitride, 
and II-VI ZnSe-based semiconductor device technolo- 
gies. J. Appl. Phys. 76:1363-1398. 

Nakamura, S. 1997. Characteristics of room temperarure- 
C\V operated InGaN multi-quantum-well-structure la- 
ser diodes. Materials Research Society's Internet J. Ni- 
tride Semiconductor Res. Vol. 2, Art. 5 and refs. there- 
in. 

Nakamura, S., N. Iwasa, M. Senoh. and T. Muki. 1992. 
Hole compensation mechanism of P-tvpe GaN' films. 
Japan. J. Appl. Phys. 31:1258. 

Neugebauer, J.. andC. G. Van de Walle. 1999. Chemical 
trends for acceptor impurities in GaN. Appl. Phvs. Lett. 
85:3003. 

Sankev, O. K, and D. J. Niklewski. 1989. Ab initio mul- 
ticenter tight-binding model for molecular-dynamics 
simulations and other applications in covalent systems. 
Phys. Rev. B 40:3979-3995. 

Strite, S.. and H. Morkoc. 1992. GaN. AlN and InN: a 
review. J. Vacuum Sci. Technol. B 10:1237-1266. 

van Schilfgaarde. M„ A. Slier, and A.-B. Chen. 1997. The- 
ory of AlN, GaN, InN and their allovs. J. Crvstal 
Growth 178:8-31. 

Wang. H., and A.-B. Chen. 2001. Calculations of acceptor 
ionization energies in GaN. Phvs Rev. B 63:125212. 

Yoder, G. B. K. Dickerson, and A.-B. Chen. 1999. Semi- 
empirical method for calculating structure and band 
gap of semiconducting polvmers. J. Chem. Phvs. Ill: 
10347-10353. 



J. Ky. Acad. Sei. 65(2):94-103. 20O4. 

Noteworthy Vascular Plants from Kentucky: A State Record, Range 
Extensions, and Various Species of Interest 

J. Richard Abbott 
Botanv Department. University of Florida, Gainesville, Florida 32611 

and 

Ralph L. Thompson and Rudv A. Gelis 

Herbarium. Biology Department. Berea College, Berea, Kentucky 40404 

ABSTRACT 

A total of 53 species is presented here, arranged in four groups: (1) a state record, Polygonum densiflonun. 
(2) range extensions in Kentucky (13 species), (3) various species of interest in the state (34 species, including 
12 new populations for species listed and tracked by the Kentucky State Nature Preserves Commission), 
and (4) cultivated species possibly naturalized in the state (5 species). 



INTRODUCTION 

The species reported here primarily repre- 
sent collections over the last several years 
based on student-related field research 
through the Berea College Herbarium (BE- 
REA). Fourteen new state records invoh~ing 
BEREA student research were recentiy pub- 
lished (Abbott et al. 2001). Several Kentucky 
fioristic projects involving BEREA students 
have also been published (Thompson et al. 
1984, 1996, 2000; Thompson and FitzGerald 
Jr. 2003; Thompson and Fleming 2004; 
Thompson and Noe Jr. 2003) and odiers have 
appeared as abstracts (Abbott and Thompson 
1993, 1994; Fleming et al. 1998; Thompson et 
al. 1995), but reports of most of the notewor- 
thy species simply have not been formally 
published. 

A recent dissertation (Medley 1993) and a 
recent book (Browne and Athey 1992) both 
provide fists of the vascular flora of Kentucky, 
but neither of them includes information from 
many of the specimens at BEREA. Ongoing 
research has also yielded additional records 
since the two checklists. Small regional her- 
baria such as BEREA are rarely utilized by 
workers outside the state; thus, dieir holdings 
remain largely unknown to other investigators. 

There are several ongoing projects in the 
state drat may culminate in a fioristic atias, a 
woody plant flora, and a manual of the flora 
of Kentucky. We report the following species 
to make knowledge of their presence available 



to odier in-state workers and the botanical 
community at large. Medley (1993) was the 
primary source for information on die distri- 
bution of species in Kentucky, but a problem 
for us is that he occasionally cited a species* 
presence in a county- based on knowledge of 
our collections vvidiout referring to our actual 
specimens. Nonetheless, vvidi very few excep- 
tions, we only report species here that fill in 
"gaps" in Medleys report. Browne and Athey 
(1992) was also referred to, but Medley has 
most of die same information, typically in 
greater detail. Any of die species below con- 
sidered endangered, threatened, rare, or spe- 
cial concern by die Kentucky State Nature 
Preserves Commission (KSNPC 2000) are in- 
dicated after the name bv KSNPC, status, and 
the year of the listing-report used. Gleason 
and Cronquist (1991) was used for distribu- 
tional information outside Kentucky and is die 
source of our nomenclature. Data on taxa not 
present in Gleason and Cronquist were found 
in Radford et al. (1968). Unless odiervvise in- 
dicated, all specimens are deposited at BE- 
REA. 

Fiftv-three species are presented here, 
placed in four groups: (1) a state record, (2) 
range extensions in Kentucky (13 species), (3) 
various species of interest in die state (34 spe- 
cies, including 12 new populations for species 
listed and tracked by the Kentucky State Na- 
ture Preserves Commission), and (4) cultivat- 
ed species that are possibly naturalized in the 
state (5 species). 



94 



Kentucky Plant Records — Abbott, Thompson, anil Gelis 



95 



KENTUCKY STATE RECORD 

Polygonum densiflorum Meissner [Polygona- 

ceae] 

Native coastal plain species that ranges from 
New Jersev south to Florida, west to Texas. 
and interior to southern Missouri (Gleason 
and Cronquist 1991). It was to be expected in 
Kentucky (Beal and Thieret 19S6), and it is 
present on the Mississippi Alluvial Coastal 
Plain in the contiguous states of Arkansas 
(Smith 1988), Missouri (Steyermark 1963), 
and Tennessee (Chester et al. 1997). Based on 
our examination of Polygonum specimens 
from Kentucky herbaria. Medley ( 1993) was 
correct in his assessment that there were not 
any Kentucky vouchers of P. densiflorum. Our 
collection is over 500 km east-northeast of any 
other collections from the above adjacent 
states. 

Madison County: Berea College Forest, 
Red Lick Reservoir No. 2, ca. 2.2 km west of 
US 421 and KY at Bighill and 0.64 km south 
off gravel maintenance road; in cattail marsh 
near the earthern dam; infrequent. 24 Oct 
2003; Thompson 03-1208, with J.R. Abbott. 

RANGE EXTENSIONS 

Castanea pumila (L.) R Mill. var. pumila [Fa- 
gaceae] KSNPC Threatened (2000). 

Johnson (1989) recorded this species as 
vouchered from eight counties in Kentucky 
but did not list Madison County. Medley 
(1993) stated there were five existing popula- 
tions but that none was known with certainty 
to exist. 

Madison County: Anglin Hollow, 2.5 km 
southeast on Long Branch Road from junction 
with Red Lick Road (KY 594); occasionally 
bush-hogged roadside wooded ledge at edge 
of field: rare, one shrub of several stems. 4 Oct 
1993; Abbott 6385, with R.L. Thompson. 

Crataegus coccinea L. [Rosaceae] 

Medley (1993) cited only one specimen, 
from Letcher County without a collector or 
number. Ross Clark [EKY] first brought this 
species to our attention bv identifying and an- 
notating the following sheets (and others at 
BEREA and EKY). 

Laurel County: Lilv Surface-mined Area, 
0.32 km south of Lilv and 3.2 km east of Kv 



25 off Lily-Mcf largue Road; rare, single tree 
on northwest outslope. 12 [un 1981; Thomp- 
son 541. with D.D. Taylor. 

Madison County: Berea College Forest, ca. 
3.2 km east of Berea on KY 21: along old pow- 
erline right-of-way north of road. 22 May 
1983; D.D. Taylor 3473. 

Rockcastle County: John 15. Stephenson 
Memorial Forest State Nature Preserve, An- 
glin Falls Ravine; south-southwest trending, 
dry midslope, rare. 28 Jul 1997; Thompson 97- 
161, with C.A. Fleming. 

Geum laciniatum Murray [Rosaceae] 

Previously known onlv along the Ohio River 
and in die coastal plain portion of western 
Kentucky (Medley 1993). As described in 
Campbell et al. (1994), the site below was dis- 
covered bv Rand}' L. Mears in 1993. 

Laurel Countv: London, 1.2 km south of 
junction with C.R. 1006 on U.S. 25, on west 
side of road; swampy bottomland remnant. 19 
Jun 1994; Abbott 6999. with R.L. Mears. This 
site was re-visited on 8 Aug 2002, and it has 
been partially developed. A large area has 
been filled in and has several large gravel 
piles. There is still a small, open, swampy strip 
adjacent to the nearbv swamp woods, but this 
species was not relocated. 

Heracleum maximum Bartr. [= H. lanatum 
Michx.] [Apiaceae] KSNPC Endangered 
(2000). 

A widespread circumboreal species. In Ken- 
tucky, known widi certainty only from Harlan 
counts' in the southeast (Medley 1993). 

Lewis County: Brush Creek Island in the 
Ohio River; late old-field; rare. 14 Jun 1995: 
Gelis BC-254. with R.L. Thompson. 

Lathyrus hirsutus L. [Fabaceae] 

Native to Europe. In Kentucky known only 
from seven western counties (Medlev 1993). 

Madison Count}': Berea College Campus, 
south of the Alumni Building and Athletic 
Field, adjacent to Scaffold Cane Road (KY 
595); fallow field. 3 Jun 1999; Abbott 12685. 

Ludwigia hirtella Raf. [Onagraceae] 

Medley (1993) reported this species from 
Edmonson and Metcalfe counties, in addition 
to Pulaski county based on the population re- 



96 



Kentucky Academy ol Science 65(2) 



icrcci on 



1 nuk l>v 



poited here, which is voucl 
collection. 

Pulaski County: near Woodstock, 2.4 km 
east on Ocala Road from junction with KY 39, 
north of Hazeldell Church of Christ; opening 
in seasonally wet upland woods, succession^ 
grass-sedge meadow, occasional. 15 Jul 1991; 
Abbott 1016, with R.L. Thompson. 

Lycopodium appressum (Chapman) Lloyd & 
Underw. [Lycopodiaceae] 
[= Lycopodiella appressa (Chapman) Cran- 
fill] KSNPC Endangered (2000). 

Known from Calloway county in the coastal 
plain portion of western Kentucky. Medley 
(1993) also cited the population listed here 
(based on our collection). 

Pulaski County: near Woodstock, ca. 1.6 km 
east on Ocala Road from junction with KY 39, 
north of road along trail; small opening in sea- 
sonally wet upland woods; rare, only one pop- 
ulation, fewer than 10 square meters. 5 Jul 
1991; Abbott 829, with R.L. Thompson. The 
population, revisited in 1994, was in stable 
condition. 

Ranunculus parviflorus L. [Ranunculaceae] 

Previously known with certainty only from 
a few counties in western Kentucky (Medley 
1993). 

Laurel County: off Willie Green Road at 
Sinking Creek, 0.32 km downstream; fallow 
field north of creek. 10 May 1994; Abbott 
6797, with R.L. Mears. 

Madison County: Fort Roonesborough 
State Park; yard in campground; rare. 21 May 
1994; Abbott 6911. 

Ranunculus pusillus Poiret [Ranunculaceae] 

Frequent in western Kentucky (Medley 
1993). 

Laurel County: London, 0.32 km east of 
junction with KY 80 on KY 192, dien south of 
highway; in mowed wet meadow, along small 
seep. 10 May 1994; Abbott 6801, with R.L. 
Mears. 

Ranunculus sardous Crantz [Ranunculaceae] 

Native to Europe. Frequent in western 
Kentucky (Medley 1993). These collections 
show the species to be fairly well established 
in central and southeastern Kentucky. 

Rell County: Fonde Surface-mined Dem- 



onstration Area; mixed hardwoods plantation, 
outslope; infrequent. 31 May L989; Thompson 
89-949. 

Casey County: adjacent to the intersection 
of U.S. 127 and 70; in a wet meadow. 1 Jul 
1988; B. Hoagland 224 [BEREA; duplicate 
from EKY; identified as R. pensylvanicus in 
Hoagland and Jones (1992)]. 

Knox County: northeast of Corbin, ca. 2 km 
northwest of U.S. 25 on KY 830; grazed open 
roadside field; frequent. 25 Jul 1992; Abbott 
3344. 

Laurel County: North Corbin; east of U.S. 
25W just north of Whitley County line; upper 
floodplain of Lynn Camp Creek. 2 May 1999; 
Abbott 12554. 

Rockcastle County: east of Disputanta, 0.3 
km east on Anglin Fork Road from Ham- 
monds Fork Road, at junction with Anglin 
Creek and Clear Creek, wet open field; fre- 
quent. 9 May 1992; Abbott 2090. 

Ranunculus sceleratus L. [Ranunculaceae] 

Frequent along the Ohio River and in west- 
em Kentucky (Medley 1993). 

Madison County: Fort Roonesborough 
State Park; sandy, open, upper beach along 
river; rare. 10 Jun 1992; Abbott 2519. 

Urochloa platijphijlla (Munro ex Wright) R. 
Webster [= Brachiaria platyphylla (Munro 
ex Griseb.) Nash] [Poaceae] 

Native southeastern species (Radford et al. 
1968). Previously known in Kentucky only 
from four western counties (Medley 1993). 

Madison County: Fort Boonesborough 
State Park; river sand and mudflats; rare. 16 
Aug 1992; Abbott 4029, with R.L. Thompson 
and R.L. Mears. 

Veronica polita Fries [Scrophulariaceae] 

Native to Eurasia. Reportedly rare in 
Campbell and Mason counties (Medley 1993). 
Medley (1993) reported Veronica agrestis (a 
very similar species) as frequent "probably 
throughout die state." We have never seen 
that species but have seen V. polita regularly 
enough to suspect diat it is undoubtedly more 
common than collections indicate and that 
there may have been some confusion in Med- 
ley's report. 

Boone County: soudi of Petersburg, 6.24 
km north on KY 20 from junction with KY 18, 



Kentucky Plant Records — Abbott, Thompson, and Gelis 



97 



then northwest at junction with Woolper 
Creek; open field along lake on creek. 13 May 
1994; Abboll 6838, with R.F.C. Naczi and R.L. 
Mears. 

Garrard County; Camp Nelson Quarry, 2.72 
km off KY 1845 from junction of U.S. 27 and 
1.6 km west-northwest of Lamber Methodist 
Church; xeric aggregated gravel floor; infre- 
quent. 1 Apr 1997; Thompson 97-189, with 
C.A. Fleming. 

Jessamine County: waste place along Ken- 
tucky River, near Brookhii Bridge. 30 Mar 
1956; DM. Smith 1261. 

Madison County: Fort Boonesborough 
State Park; yards; frequent. 5 Mar 1992; Ab- 
bott 1322, with R.L. Thompson and G. Dan- 
deneau. 

VARIOUS SPECIES OF INTEREST 

Achyranthes japonica (Miq.) Nakai [Amaran- 
thaceae] 

Native to eastern Asia. Previously reported 
for three counties along Tug Fork in eastern 
Kentucky. Medlev (1993) also mentioned that 
the species is probably spreading, as con- 
finned by this collection and by Vincent and 
Cusick (1998), who reported it new to Ohio. 

Lews County: Brush Creek Island in the 
Ohio River; forested wetland; abundant. 3 Sep 
1995; Gelis BC-1077. with R.L. Thompson. 

Aconitnm uncinatum L. [Ranunculaceae] 
KSNPC Threatened (2000). 

Previously reported from five counties from 
northern to southeastern Kentucky, including 
Laurel (Medley 1993). This collection repre- 
sents a new population. 

Laurel Count)': London, University of Ken- 
tucky Feltner 4-H Camp; gravelly streambank; 
rare. 25 Sep 1999; Thompson 99-1060, with 
E.W.J. FitzGerald Jr. 

Aegopodiurn podagraria L. [Apiaceae] 

Native to Eurasia; escaped in northeastern 
United States. Previously reported only from 
Jefferson county in Kentucky (Medley 1993). 

Lewis County: Manchester Island No. 1 in 
the Ohio River; mature bottomland hard- 
woods; rare. 8 Jun 1996; Gelis Ml-1211, with 
C.L. Fleming. 

Alopecurus pratensis L. [Poaceae] 



Native lo Eurasia, widespreadlv naturalized 
in the United Slates. Previously reported as 
rare in a few counties in northern Kentucky 
(Medlev 1993). 

Madison County: Berea College Forest, 1 
mi south of Bighill, 175 feet from KY 421 
roadside on northwest trending side slope 
dominated bv serieea lespede/.a. 16 May 2003; 
Thompson 03-50. with D.B. Poindexter. 

Cacalia snavcolcns L. [Asteraceae] 

Known mostly from western Kentucky but 
also from unverified reports in a few other 
scattered counties (Medley 1993). 

Lewis County: Manchester Island No. 1 in 
the Ohio River; rare along shaded riverbank. 
29 Jul 1995; Gelis Ml-767, with R.L. Thomp- 
son, J.R. Abbott, and A.E. Shupe. 

Camelina microcarpa Andrz. [Brassicaceae] 

Native to the Old World. Previously known 
from a few counties in northern and central 
Kentucky (Medley 1993). 

Laurel Counts': London, east of U.S. 25 on 

J 

KY 1006 toward Le\i Jackson Wilderness 
Road State Park, along gravel embankment of 
railroad tracks. 19 Jun"l994; Abbott 5187, with 
R.L. Mears. 

Cardamine impatiens L. [Brassicaceae] 

Native to Europe and introduced into die 
coastal states west to Michigan (Gleason and 
Cronquist 1991). Medley (1993) fisted only 
Campbell and Jefferson counties in Kentucky-. 

Lewis County: Manchester Island No. 1 in 
the Ohio River; late oldfield; frequent. 4 May 
1995; Gelis Ml-71, with D. Snell. 

Carex pedunculata Muhl. [Cyperaceae] 

When the population below was vouchered, 
it was only the second known site for this spe- 
cies in Kentucky (Thompson et al. 2000). Now 
known in several counties in eastern Kentucky 
(Medley 1993). 

Laurel County: Rock Creek Research Nat- 
ural Area; mixed mesophytic hemlock forest 
near a small rockhouse recess on conglomer- 
ate ledge; very infrequent. 21 \pr 1985: 
Thompson 85-77. Verified by Dr. Robert FC. 
Naczi. Delaware State University. 

Chenopodium pumilio R. Br. [Chenopodi- 

aceael 



98 



fournal of the Kentucky Academy of Science 65(2) 



Native to Australia. In Kentucky known pre- 
viously from Trimble and Fayette counties 
(Medley 1993). 

Lewis County: Manchester Island No. 1 in 
the Ohio River; seasonally flooded and eroded 
sandy bank, 28 Jul 1995; Abbott 7808, with 
R.L. Thompson and R.L. Gelis. 

Chrysosplenium americanum Schwein. [Saxi- 
fragaeeae] KSNPC Endangered (2000). 

Rare in southeastern Kentucky (Medley 
1993). Already known from Harlan County, 
but we report a new population. 

Harlan County: Pine Mountain Settlement 
School; wooded spring seep into Issacs Creek; 
infrequent. 26 Mar 1998; Thompson 98-14. 

Cypripedium calceolus L. var. parviflorum 
(Salisb.) Fern. [= C. parviflorum Salisb.] 
[Orchidaceae] KSNPC Threatened (2000). 

Previously known from a few scattered lo- 
cations in eastern Kentucky (Medley 1993). 
Our collection was the basis of Medleys 
(1993) report from Laurel county. 

Harlan County: Sheppard Trail, near Pine 
Mountain Settlement School; on roadside em- 
bankment. 3 Jun 1997; Thompson 97-1298. 

Laurel County: Rock Creek Research Nat- 
ural Area uplands, northeast-facing pine-oak 
stand; rare. 7 May 1989; Thompson 89-644. 

Disporum maculatum (Buckl.) Britt. [Lili- 
aceae] KSNPC Special Concern (2000). 

Known from several eastern counties in 
Kentucky, including Bell and Harlan (Medley 
1993), but our collections voucher new pop- 
ulations. 

Bell County: Fonde Surface-mined Dem- 
onstration Area; on highwall; infrequent. 21 
Apr 1990, Thompson 90-278. 

Harlan County: Pine Mountain Settlement 
School; north-trending mesic lower slope 
along the Split Rock Trail; infrequent to rare. 
19 April 1988; Thompson 88-279. 

Eriophorum virginicum L. [Cyperaceae] 

Previously known in Kentucky only from 
Harlan county (Medley 1993). 

Laurel County: south of Flatwoods and west 
of Frozen Camp Creek, in powerline right-of- 
way; wet sandy opening (disturbed drainage 
channel); several dozen fertile stems seen. 30 



Jul 1993; Abbott 5897, with J.J.N. Campbell 
and S. Walker. 

Flocrkca proserpinacoides Willd. [Limnantha- 

ceae] 

Medley (1993) reported this species as rare 
near streams along the Ohio River in northern 
Kentucky, all west of diese collections. 

Lewis County: Manchester Island No. 2 in 
the Ohio River; mature bottomland hard- 
woods; occasional. 4 May 1995: Gelis A/2-75, 
with D. Snell. 

Gentiana flavida A. Gray [Gentianaceae] 
KSNPC Endangered (2001). 

Previously reported from several scattered 
counties, some unvouchered or with uncertain 
identifications (Medley 1993). 

Madison County: between Brushy Knob 
and Hacker Smith Mountain, near Lick Fork- 
Creek; ca. 20 stems at edge of yard and rem- 
nant cedar glade thicket. 21 Aug 2002; 
Thompson 02-392, with M. Evans. 

Geranium dissectum L. [Geraniaceae] 

Native to Europe. Previously known from 
northern Kentucky in two counties, with a few 
other unverified reports (Medley 1993). 

Madison County: Berea College Campus, 
south of Kettering Residence Hall and Agri- 
culture Greenhouses; along edge of cultivated 
field adjacent to Scaffold Cane Road (KY 595); 
locally abundant. 23 Apr 1999; Abbott 12458. 

Hexastylis heterophylla (Ashe) Small [Aristo- 
lochiaceae] 

Known previously from Bell and Harlan 
counties (Medley 1993). Gleason and Cron- 
quist (1991) treated the species as conspecific 
under H. virginica. According to Gaddy 
(1987), this species is distinct from H. virgin- 
ica. Our plants have predominantly erect calyx 
lobes mostly 3-4 mm long (characteristics of 
H. virginica), and the details of the reticula- 
tion along the internal calyx of some flowers 
are also reminiscent of H. virginica, with rel- 
atively low relief and no distinct vertical ridg- 
es. Thus, we were tempted to follow Gleason 
and Cronquist. However, some calyx lobes are 
strongly reflexed and a few are ca. 5 mm long 
(especially when fresh), and some calices have 
a pronounced internal reticulation with dis- 
tinct vertical ridges (characteristics of H. het- 



Kentucky Plant Records- Aliboll. Timings, 



son, a in 



I Gelis 



99 



erophi/lla). Even the (lowers that are most like 
//. virgin ica, though, have anther connectives 
which are exerted beyond the anther (a dis- 
tinctive //. heterophylla characteristic). Final- 
ly, Rob Nac/.i, of Delaware State University, 
who has field experience with many Hexastylis 
species, looked at our vouchers and then vis- 
ited the site, concluding that, overall, our pop- 
ulation is more like H. heterophylla than H. 
virginica. 

Laurel County: ca. 100 m west of 1-75 at 
junction with the Laurel River; a few plants 
near the river, more common upslope. 9 Apr 
1994; Abbott 6532. 

Liiuiin usitatissimum L. [Linaceae] 

Known previously from Fulton County in 
western Kentucky (Medley 1993) and report- 
edly vouchered from Madison County by Lib- 
by et al. (1997), although, contrary to the re- 
port, no specimen was left at BEREA. 

Pulaski County: northeast of Hazeldell 
Church of Christ, ca. 1 mile west of junction 
with Alexander Road on Ocala Road; adven- 
tive in fallow field [near roadside edge]; rare. 
2 Jul 1992; Abbott 2847, with R.L. Thompson. 

Liparis loeselii (L.) L.C. Richard [Orchida- 
ceae] KSNPC Threatened (2000). 

Previously reported from a few counties in 
eastern Kentucky (Medley 1993). Thompson 
and MacGregor (1987) reported it from Bell 
County. 

Clark County: abandoned limestone quarry, 
1.4 km west of junction with KY 1924 on KY 
418 and 0.32 km east of Lisletown (Halls on 
the River), adjacent to Kentucky- River; raised 
spot in cattail-rush marsh; rare. 5 Aug 1994; 
Thompson 94-701, with E.W.J. FitzGerald, Jr. 

Lobelia nuttallii Roemer & Schultes [Cam- 
panulaceae] KSNPC Threatened (2000). 

Medley (1993) reported this species from 
four counties in southeastern Kentucky, in- 
cluding Laurel and Whitley, based partly on 
our collections. Campbell et al. (1994) report- 
ed several other populations in Laurel and 
Whitley counties, also based partly on our col- 
lections. 

Laurel County: Lily Surface-mined Area, 
0.32 km south of Lily and 3.2 km east of U.S. 
25 off Lilv-McHargue Road; old outslope 



pond embankment; rare. 28 |un 1 98 1 ; Thomp- 
son 81-653, with D.I). Taylor. 

McCreary County: 0.8 km north off U.S. 27 
from Scott County (TN) line, and west on 
Cline Road for 0.48 km; wet meadow portion 
of field adjacent to mixed hardwoods stand; 
infrequent. 10 Aug 1993; Thompson 93-465. 

Whitley County: south of Bark Camp, 0.8 
km south of FS. 191 from junction with KY 
1 193; in a mowed powerline right-of-way 
along edge of mixed pine-oak woods; rare. 1 
Aug 1993; Thompson 93-447, with J.R. Abbott 
and A.E. Shupe. 

Lysimachia vulgaris L. [Primulaceae] 

Native to Eurasia. Rare in three counties 
along the Ohio River, west of this collection 
(Medley 1993). 

Lewis County: Manchester Island No. 1 in 
the Ohio River; unconsolidated shoreline; 
rare. 22 fun 1996; Gelis Ml-1263, with CA. 
Fleming. 

Oenothera linifolia Nutt. [Onagraceae] 
KSNPC Endangered (2000). 

Rare in four western Kentucky counties and 
McCreaiy County in southeastern Kentucky 
(Medley 1993). 

Pulaski County: near Woodstock, 2.2 km 
east on Ocala Road from junction with KY 39, 
NW of Hazedell Church of Christ; in fallow- 
field; rare. 23 Jul 1992; Abbott 3280, with R.L. 
Thompson. 

Papaver (labium L. [Papaveraceae] 

Native to Europe. Only known from Camp- 
bell and Kenton counties in northern Ken- 
tucky (Luken and Thieret 1987). 

Madison County: near Redhouse, Louis\ille 
and Nashville Railroad right-of-way, 0.32 km 
north on KY 388 from junction of KY 3372; 
infrequent. 17 May 1998; Thompson 98-157. 

Nicholas County: between gas pipeline and 
roadside off U.S. 68, 4 km southwest of Ellis- 
\ille; scattered group of 20 plants. 27 May 
1995; Gelis 326, with R.L. Thompson and D. 
Snell. 

Platanthera integrilabia (Correll) Luer [Or- 
chidaceae] KSNPC Threatened (2000). 

A federal candidate for listing (USFWS 
1999). Medley (1993) listed three counties 
from southern Kentucky. 



KM) 



Journal <>l the Kentucky Acadernj ol Science 65(2 



Laurel County: Marsh Branch Road (F.S. 
774), ca. 0.96 km south of KY 192. then north- 
east ca. 0.48 km in ravine just north of F.S. 
4108; wet swampy streamhead in open woods: 
one large extended narrow population of hun- 
dreds of plants. 31 Jul 1993; Abbott 5954. 

Poa bulbosa L. [Poaceae] 

Native to Europe. Known from one count) 7 
in northern Kentucky and three counties in 
western Kentucky (Medley 1993). 

Laurel County: London. Le\i Jackson Wil- 
derness Road State Park; near campground 
restrooms; forested roadside widi mowed un- 
derstory. 10 May 1994; Abbott 6776, with R.L. 
Mears. 

Madison Countv: Berea, along slope behind 
buildings at soudieast corner of Chestnut and 
Boone streets: remnant woodland slope. 20 
Apr 1992; Abbott 1911. 

Ranunculus ficaria L. [Ranunculaceae] 

Native to Eurasia. Previously known in Ken- 
tucky from three counties along die Ohio Riv- 
er, west of diese collections (Medlev 1993). 

Lewis Countv: Manchester Island No. 1 in 
the Ohio River; mature bottomland hard- 
woods; rare. 11 Apr 1995; Gelis Ml-35, with 
R.L. Thompson. 

Rliamnus frangula L. [Rhamnaceae] 

Native to Eurasia. Previously onlv vouch- 
ered as naturalized in Jefferson and Laurel 
counties (Medlev 1993). Our site represents a 
new population. 

Laurel Countv: London, University of Ken- 
tucky Feltner 4-H Camp; mesic oak-pine for- 
est below earthen dam embankment along 
creek; rare. 16 May 2002; Thompson 02-44, 
with E.W.J. FitzGerald, Jr. 

Scirpus fluviattlis (Ton - .) Gray [Cvperaceae] 
KSNPC Threatened (2000).' 

Previously listed for two counties in extreme 
western Kentucky (Medlev 1993), and Jones 
(1994) reported it from Madison Counts'. Our 
collection is the easternmost documented for 
Kentucky. 

Bell Countv: Fonde Surface-mined Dem- 
onstration Area; settling pond edge; rare. 12 
Aug 1989; Thompson 89-1273. 

Sherardia aroensis L. [Rubiaceae] 



Native to western Eurasia and northern Af- 
rica. Known previously from three scattered 
counties in Kentucky (Medley 1993). 

Madison County: Fort Boonesborough 
State Park; mowed grass-legume field on west 
side of KY 388; locally abundant. 8 May 1996; 
Abbott 8565, with R.L. Thompson and B.S. 
Carlsward. 

Sicla hermaphrodita (L.) Rusbv. [Malvaceae] 
KSXPC Special Concern (2000). 

Medley (1993) reported this species from 
several other counties along the Ohio River in 
Kentucky. 

Lewis Countv: Manchester Island No. 2 in 
the Ohio River; late oldfield; rare, one eolonv 
located near island head. 21 Jul 1995; Gelis 
M2-51 7. 

Silene ovata Pursh [Carvophvllaceae] KSXPC 
Threatened (2000). 

Previously reported from five counties 
(Medlev 1993), including Bell, which is un- 
doubtedly based on this voucher. 

Bell Countv: Log Mountain Surface-mined 
Demonstration Area; wooded outslope; infre- 
quent. 26 Jul 1985; Thompson 85-1420, with 
R.A. Straw" 

Spiranthes lucida (H. Eaton) Ames [Orchida- 
ceae] KSNPC Threatened (2000). 

Medlev (1993) reported this species from 
seven counties (but some as sight records 
onlv) in soudiem central to southeastern Ken- 
tucks-. 

Clark Counts': abandoned limestone quarry, 
1.4 km west of junction with KY 1924 on KY 
418 and 0.32 km east of Lisletown, adjacent 
to Kentucky River; rare, a single eolonv in die 
Juniperus xeric community at die edge of a 
small pond. 17 Jun 1994; Thompson 94-426, 
with J.R. Abbott. 

Stellaria aquatica (L.) Scop. [= Myosoton 
aquaticum (L.) Moench] [Carvophvllaceae] 

Native to Europe. Previously reported as 
rare on river banks and seeps of five counties 
along die Ohio River (Medley 1993). 

Lewis Counts': Brash Creek Island in die 
Ohio River; unconsolidated shoreline; fre- 
quent. 27 May 1995; Gelis BC-1S4. with R.L. 
Thompson. 



Kentucky Plant R 



ecorus- 



-Abbott, Th 



ompson. 



and Gelis 



101 



Vallisneria americana Michx. [Hydrocharita- 
ceae] 

Known previously from two counties farther 
west (than this collection) along the Ohio Riv- 
er and from a few other scattered counties in 
Kentucky (Medley 1993). 

Lewis County: Manchester Island No. 2 in 
the Ohio River; aquatic lied; infrequent. IT 
Aug 1995; Gelis M2-860, with H.I, Thomp- 
son. 

CULTIVATED SPECIES POSSIBLY 
NATURALIZED 

The following species are included as they 
appeared to us to have been non-cultivated. It 
is possible, however, that they were planted 
main- decades ago, although no homesite rem- 
nants were seen. Some of them were certainly 
spreading in the immediate area. Nonedieless, 
it it were possible to know the entire site his- 
tory, perhaps all but the Euonymus and Li- 
gustrum could be seen as having spread from 
cultivation or as persisting and may not truly 
be naturalized (e.g., Nesom 2000). 

Akebia quinata (Houtt.) Dene. [Lardizabala- 
ceae] 

Native to eastern Asia. Previously- known in 
Kentucky from Jefferson County (Medlev 
1993). 

Rockcastle Countv: Daniel Boone National 
Forest, ca. 0.64 km from KY 1004 on a forest 
service road: roadside pine clear-cut area; rare. 
27 Jul 1991; Thompson 91-739, with D.D. 
Taylor. 

Euonymus alata (Thunb.) Siebold [Celastra- 
ceae] 

Native to eastern Asia. Medlev (1993) re- 
ported this species as infrequently naturalized 
in a lew scattered counties in Kentucky. 

Lewis Countv: Manchester Island No. 1 in 
the Ohio River;' oldfield; rare. 8 Jun 1996; Cel- 
ls Ml-1207. with CA. Fleming. 

Madison County: Berea College Campus, 
south of the Alumni Building and Athletic 
Field, along cross-country trail past Brushy 
Creek; mostly disturbed secondary hardwood 
forest, but with several scattered, exotic, usu- 
ally-cultivated plants: apparently spontaneous, 
dozens of individuals seen along creek. 3 Inn 
1999; Abbott 12681. 



Kerria japonica <\,.> DC. [Rosaceae] 

Native to China and Japan. Medlev i L993) 
mentioned ii from cultivation. Gleason and 

Cronquist (2001) included this species as an 
occasional escape from cultivation. 

I Lilian County: I'ine Mountain Settlement 
School; persisting in mixed mesoplivtie woods 
from site ol old burned library near Issai s 
(ieek: rare. 19 Apr HISS; Thompson SS-219. 
This species was also collected at Pine Moun- 
tain Settlement School as an apparently culti- 
vated shrub near a woodland margin far from 
any buildings (Abbott 8585). This latter collec- 
tion demonstrates how a planting in an out- 
of-the-way place could later be seen as possi- 
bly naturalized, especially when decades have 
passed and site usage has changed. 

Madison Countv: Berea College Forest, ca. 
3.68 km east of Berea on KY 21 from junction 
with KY 595; pine-oak woodland strip along 
north side of road; one multi-stemmed shrub 
growing at base of, and surrounded by, native 
trees and shrubs. 23 April 1993; Abbott 4674. 
Perhaps persisting from cultivation long ago 
but there is no evidence or local record of an 
old homesite in the immediate area. Not ap- 
parently spreading here. This could represent 
an escape from recent cultivation somewhere 
nearby. 

Ligustrum obtusifolium Siebold & Zucc. [Ole- 
aceae] 

Native to eastern Asia. In disturbed areas in 
Favette and Oldham counties (Medlev 1993). 
Based on several specimens recently annotat- 
ed at BEREA by Ross Clark (EKY), this spe- 
cies is much more commonly naturalized than 
previously reported. 

Garrard Countv: Camp Nelson Quarry, 2.7 
km on KY 1845 from junction with US 27: dry 
quarry floor near highwall talus area; rare, two 
fruiting shrubs. 2 Aug 2004: Thompson 04- 
1105. 

Madison Countv: Berea College Campus, 
south of the Alumni Building and Athletic 
Field along cross-country trail past Brush) 
Creek; mostly disturbed secondary hardwood 
forest, but with several scattered, exotic, usu- 
ally-cultivated plants; numerous individuals ol 
various sizes present. 3 |un 1999: Abbott 
12682. 

Rockcastle Countv: |ohn B. Stephenson 



102 



Journal oi the Kentucky Academy <>i Science 65(2) 



Memorial Forest State Nature Preserve, An- 
glin Falls Ravine; northwest-trending lower 
slope in Pinus-Liriodendron-Quercus com- 
munity: infrequent. 3 Oct 1997; Thompson 97- 
344, with A.N. Allen. 

Lijcinm barbarian L. [Solanaceae] 

Native to temperate Eurasia. Documented 
as sparingly naturalized along a few roadsides 
and creeks in four Kentucky counties, mostly 
on limestone-based soils (Medley 1993). 

Clark Count): roadside ditch along KY 418 
ca. 0.16 km from junction widi KY 1924; rare, 
site discovered by Ross Clark. 26 Sep 2003; 
Thompson 03-1066. 

Madison County: Berea College Campus 
near Agriculture Annex; clustered in cut-back 
Moms alba. 19 Sep 1985; Thompson 85-1632. 

LITERATURE CITED 

Abbott, J. R., and R. L. Thompson. 1993. A relict colony 
of coastal plain species on the eastern Mississipian Pla- 
teau in Pulaski County, Kentucky. The 54th Annual 
Meeting, Association of Southeastern Biologists. Old 
Dominion Univ., Virginia Beach, VA, 16 April. ASB 
Bull. 40:149. [Abstract]. 

Abbott, J. R., and R. L. Thompson. 1994. A floristic survev 
of Fort Boonesborough State Park, Madison County, 
Kentucky. The 55th Annual Meeting, Association 
Southeastern Biologists. Central Florida Univ., Orlando, 
FL, 14 April. ASB Bull. 41:91. [Abstract]. 

Abbott, J. R.. R. L. Thompson, and R. L. Gelis. 2001. 
Vascular plants new to Kentuckv. Sida 19:1199-1202. 

Beal. E. O., and J. W. Thieret. 19S6. Aquatic and wetland 
plants of Kentucky. Kentucky State Nature Preserves 
Comm. Sci. Techn. Ser. 5. 

Browne, E. T, Jr., and R. Athey. 1992. Vascular plants of 
Kentucky: an annotated checklist. Univ. Press of Ken- 
tucky, Lexington, KY. 

Campbell, J. J. N., J. R. Abbott, R. R. Cicerello, J. D. 
Riser, J. H. MacGregor, and J. G. Pahs. 1994. Coop- 
erative inventory of endangered, threatened, sensitive 
and rare species, Daniel Boone National Forest: Lon- 
don Ranger District. Kentucky State Nature Preserves 
Commission, Frankfort, KY. 

Chester, E. W., B. E. Wofford, and R. Krai. 1997. Atlas 
of Tennessee vascular plants, Vol. 2. Angiosperms: di- 
cots, Misc. Publ. 13, The Center for Field Biology, Aus- 
tin Peay State Univ., Clarksville, TN. 

Fleming, C. A., R. L. Thompson, and R. A. Gelis. 1998. 
Wetland and aquatic vascular flora of five reservoirs in 
the Berea College Forest, Madison and Jackson Coun- 
ties, Kentuckv. The 59th Annual Meeting, Association 
of Southeastern Biologists. Northeast Louisiana Univ., 
Monroe, April 16. ASB Bull. 45:91. [Abstract]. 

Gaddy, L. L. 1987. A review of the taxonomy and bioge- 



ograph) ol Hexastylis (Aristolochiaceae I astanea 52: 

186-196. 

Gleason, H. A., and A. Cronquist. 1991. Manual nl\ os- 
cular plants of northeastern United States and adjacent 
Canada. 2nd ed. New York Botanical Garden, Bronx, 
NY. 

Hoagland, B. W., and B. L. Jones. 1992. Wetland and 
riparian flora of the Upper Green River Basin, south- 
central Kentucky. Trans. Kentuckv Acad. Sci. 53:141- 
153. 

Johnson, G. P. 1989. Castanea and Fagus (Fagaceae) in 
Kentucky. Trans. Kentucky Acad. Sci. 50:75-78. 

Jones, R. L. 1994. New localities for rare or infrequent 
vascular plants of Kentuckv. Trans. Kentuckv Acad. Sci. 
55:139-141. 

[KSNPC] Kentuckv State Nature Preserves Commission. 
2000. Rare and extirpated plants and animals of Ken- 
tucky. J. Kentucky Acad. Sci. 61:11.5-132. 

Libbv. G W., R. L. Mears, and C. T Bloom. 1997. Note- 
worthy vascular plant discoveries from Kentucky. Trans. 
Kentucky Acad. Sci. 58:74-79. 

Luken, J. O., and J. W. Thieret. 1987. Linum grandiflorum 
(Linaceae), Papaver dubium (Papaveraceae), amd Sal- 
via pratensis (Labiatae): additions to the Kentucky flora. 
Trans. Kentucky Acad. Sci. 48:26. 

Medley, M. E., R. Cranfill, L. R. Phillipe, and R. Hannan. 
1980. Sundews in Kentucky and notes on their only ex- 
isting habitat in die state. Unpublished abstract pre- 
sented at the 66th annual meeting of the Kentucky 
Academy of Sciences, on file with the Kentuckv- State 
Nature Preserves Commission, Frankfort, KY. 

Medley, M. E. 1993. An annotated catalog of die known 
or reported vascular flora of Kentucky. Ph.D. Disser- 
tation. Univ. Louisville, Louisville, KY. 

Nesom, G L. 2000. Which non-native plants are included 
in floristic accounts? Sida 19:189-193. 

Radford, A. E., H. E. Ahles, and C. R. Bell. 1968. Manual 
of the vascular flora of the Carolinas. Univ. North Car- 
olina Press, Chapel Hill, NC. 

Smidi, E. B. 1988. An adas and annotated list of the vas- 
cular plants of Arkansas. 2nd ed. Privately published by 
Edwin B. Smidi, Univ. Arkansas Bookstore, Fayette- 
\ille. AR. 

Steyermark, J. A. 1963. Flora of Missouri. Iowa State 
Univ. Press, Ames, LA. 

Thompson, R. L., J. R. Abbott, and A. E. Shupe. 1995. 
Vegetation and vascular flora of an abandoned lime- 
stone quarry, Clark County Kentucky. The 56di Annual 
Meeting, Association of Southeastern Biologists. Univ. 
Tennessee, Knoxville, 23 April. ASB Bull. 42:85. [Ab- 
stract]. 

Thompson, R. L., and E. W. J. FitzGerald Jr. 2003. Vas- 
cular flora of Feltner Lake, Laurel County, Kentucky. 
J. Kentucky Acad. Sci. 64:75-92. 

Thompson, R. L., and C. A. Fleming. 2004. Vascular flora 
and plant communities of the John B. Stephenson Me- 
morial Forest State Nature Preserve (Anglin Falls Ra- 



Kentucky Plant Records — Abbott, Thompson, and Gelis 



L03 



vine), Rockcastle County, Kentucky. Castanea 69:125- 
138. 

Thompson. R. [,.. R. L. Jones, J. It. Abbott, and W. N. 
Denton. 2000. Botanical Survey of Hock Creek Re- 
search Natural Ana. Kentucky. U.S. I). A. Foresl Ser- 
vice, Northeastern Research Station. General Technical 
Report NE-272. Newtown Square, PA. 

Thompson, R. L., ami J. R. MacGregor. 1986. Liparisloe- 
sclii (Orchidaceae) documented in Kentucky. Trans. 
Kentucky Acad. Sei. 47:138-139. 

Thompson, R. L„ and F. D. Noe Jr. 2003. American mis- 
tletoe (Phoradendron leucarpum, Viscaceae) in Rock- 
castle County, Kentucky. J. Kentucky Acad. Sei. 64:29- 
35. 

Thompson, R. L., \V. G. Vogel, and D. D. Taylor. 1984. 
Vegetation and flora of a coal surface-mined area in 
Laurel County. Kentucky. Castanea 49:1 1 1-126. 



Tl pson, 11. I... G. L. Wade, and R, A Straw. 1996. 

Natural anil planted flora ol l.og Mountain Surface- 
mined Demonstration Area, Hell County Kentucky. 
Pages 484-503 in Successes and failures: applying re- 
search results to insure reclamation success. Proceed- 
ings. 13th Annual National Meeting, American Society 
of Surface Mining and Reclamation (ASSMR), May 18- 
23, Univ. Tennessee. Knoxville, TN. 

[USFWS] United States Fish and Wildlife Service. 1999. 
Endangered and threatened wildlife and plants, review 
of plant and animal taxa that are candidates or proposed 
for listing as endangered or threatened. Fed. Hrgistei 
64:57533-575 17 

Vincent, M. A., and A. W. Cusick. 1998. New records of 
alien species in the Ohio vascular flora. Ohio J. Sei. 98: 
10-17. 



J. Ky. Acad. Sd. 65(2):104-107. 2004. 

A PCR-Based F, Hybrid Screen Using the Beta-aetin Genes from the 
Sunfishes Lepomis cyanellus and L. macrochirus (Centrarehidae) 

David K. Peyton 
Department of Biological and Environmental Sciences, Morehead State University, Morehead. Kentuck) 40351 

ABSTRACT 

Hybrids between closely related fish species are widely propagated in aquaculture and known to occur in 
many instances under natural conditions. The resulting hybrids often do not have characters that distinguish 
them definitively from the multiple possible parent species, making field identification difficult or impossible. 
This can be particularly difficult with juvenile specimens and adults who are not displaying breeding color- 
ation. Lepomis species are capable of producing many hybrids, and L. macrochirus X L. cyanellus hybrids 
are produced commercially and released into private and public waters. This hybrid, easily distinguishable 
by morphology from its parent species, provided a good model to test a molecular identification tool. In this 
study I describe a method to design an unambiguous polymerase chain reaction (PCR) screen for hybrids 
that can be performed on living or dead specimens, requires minimal and non-invasive tissue sampling, is 
rapid and inexpensive, and can be adapted for any species. 



INTRODUCTION 

The problem of correctly identifying hybrid 
offspring in closely related fish species is com- 
pounded by the complex genetic interactions 
that may occur between the chromosomal 
contributions of the parent species. Morpho- 
logical traits can often identify candidate pa- 
rental species but confirmation is seldom pos- 
sible. Moreover, F! hybrid offspring may vary 
from each other due to crossing over in pa- 
rental gametes, and the outcome may also dif- 
fer between crosses if the gender of the par- 
ticular species is varied (i.e., male Lepomis cy- 
anellus X female L. macrochirus versus fe- 
male L. cyanellus X male L. macrochirus) 
(Childers 1967). Even non-hybrid juveniles of 
some species can be difficult to identify cor- 
rectly without tedious scale counts and dissec- 
tion. Application of a molecular test with un- 
ambiguous results provides a definitive medi- 
od to ascertain correctly the identity of a fish 
as well as to determine whether or not the 
specimen is a hybrid. 

Common molecular techniques for fish 
identification are allozymes, microsatellite 
markers, or other DNA profiling strategies 
such as restriction fragment length polymor- 
phisms (RFLPs) (Avise and Saunders 1984; 
Neff 2001). While these are effective and re- 
liable in most circumstances, characterizing 
polymorphisms in the genome can be time- 
consuming, and evaluating the mediods for 
statistical reliability can be overwhelming and 



costly. With relatively inexpensive reagents for 
polymerase chain reaction (PCR) and increas- 
ing knowledge of fish genomics, more precise 
strategies are possible. 

An alternative approach, presented here, is 
to look for intronic polymorphisms in a con- 
served gene diat can distinguish species that 
are otherwise nearly identical at die genetic- 
level. This approach has several advantages. 
First, consensus primers to exonic sequences 
can be used to isolate the gene from multiple 
species for sequence analysis. Second, poly- 
morphisms can be chosen that are not hyper- 
variable in nature. Therefore, these polymor- 
phisms are likely to be found universally with- 
in a single species with few exceptions. Third, 
because introns tend to span large distances, 
it may be possible to design primer sets that 
can screen for multiple species with multiple 
possible PCR product lengths in a single re- 
action. Lastly, because the length will likely be 
much longer than a typical microsatellite, anal- 
ysis can be performed on simple agarose gels 
instead of high resolution polyacrylamide gels. 

The gene chosen in this study is the cyto- 
plasmic beta-actin gene, a member of the ac- 
tin gene family. This gene is highly conserved 
across kingdoms, has little or no variation at 
the amino acid level, and is highly conserved 
at the nucleotide level in teleosts. There are 
at least six, and possibly as many as nine, actin 
family members in teleosts (Venkatesh et al. 
1996). Beta-actin can be distinguished from 



104 



PCR-Based F, Hybrid Screen— Peyton 



105 



other actins by the signature amino acids at 
each terminus of the coding sequence. Within 
the heta-actin gene, the introns are valuable 
phylogenetic markers (Lee and Gye 2001 ). In 
this study, primers were designed to hybridize 
to unique regions in the first intron ol the 
beta-actin gene in two sunfish (family Cen- 
trarchidae), creating different products in 
each species and providing a rapid technique 
for identification of hybrids. The application of 
this approach to other species and other fam- 
ilies is discussed. 

MATERIALS AND METHODS 

Specimens 

Lepomis cyanellus and L. macrochirus spec- 
imens were collected from South Elkhorn 
Creek in Woodford Count}', Kentucky, and 
from Town Branch in Fayette County, Ken- 
tucky. Lepomis cyanellus X L. macrochirus 
hybrid specimens were purchased from the 
Jones Fish Hatchery (Cincinnati, OH). 

Isolation of Genomic DNA 

Small fin clip biopsies (5 mm 2 ) from eight 
fish were incubated in 250 (xl lvsis buffer (100 
raM Tris, 5 mM EDTA, 0.2% SDS, 200 mM 
NaCl), and 5 julI proteinase K (from a 100 |xg/ 
ml stock solution) at 52°C for 2 hours. Sam- 
ples were vortexed and centrifuged in a mi- 
crofuge for 8 minutes at top speed. The su- 
pernatant was then transferred to a fresh tube 
containing 400 (jlI isopropanol. The tube was 
inverted 10 times and centrifuged for 1 mi- 
nute at top speed, and the supernatant was 
removed and discarded. The pellet was 
washed with 95% ethanol, dried briefly, then 
resuspended in water. 

Cloning of Beta-actin Genes 

Beta-actin whole gene primers were de- 
signed to hybridize with the first 9 and the last 
9 codons of the cytoplasmic beta-actin gene 
based on conserved sequences in available da- 
tabase entries. Whole gene primers were as 
follows: Forward: 5' atg gat gat gaa ate gec gca 
ctg gtt 3'; Reverse: 5' tta gaa gca ttt acg gtg 
gac gat gga 3'. Cycle parameters were: 95°G 
for 15 minutes, followed by 30 cvcles of (95°C 
for 30 sec, 47°C for 30 sec, 72°C for 1 mi- 
nute). The genomic fragment produced from 
each fish was ca. 2 kb and was cloned into the 
pGEM-T Easy vector (Promega). Candidate 



clones were sequenced and compared to 
known beta-actin genes for verification, and 
die exons were determined using consensus 

splice sites and the \iiiualK invariant lirtu-ac- 
t i 1 1 amino acid sequence. 

Amplification ol Polymorphic Regions 

The polymerase chain reaction was carried 
out with each sample using the following 
amounts: 5 |jl1 genomic DNA (from a 10 ng/ 
(jlI stock), 1.5 u.1 of each primer (from a 10 ng/ 
u.1 stock), 12.5 uJ of 2X Thermoscript PCR 
master mix (Marsh Bioproducts), and water 
up to 25 |jl1. The Exon 1 Forward Primer 
(EXIF) sequence is: 5' tgg ttg ttg aca acg gat 
ccg gta tgt gca 3'. The L. macrochirus reverse 
primer (MRP) is 5' tta aaa ggt aaa gat ctt gac 
tac atg tac g 3'. The L. cyanellus reverse prim- 
er (CRP) is 5' tgg tta gac etc att aga tgt cag 
cat atg 3'. The cycle parameters lor the prim- 
ers used in this study were as follows: 95°C for 
15 minutes, followed by 30 cycles of (95°C for 
30 sec, 47°C for 30 sec, and 72°C for 1 mi- 
nute). Samples were electrophoresed on a 
1.5% agarose gel and visualized using ethi- 
diuni bromide staining. 

RESULTS 

Exon 1 and intron 1 of the beta-actin genes 
from L. cyanellus and L. macrochirus are 
shown in Figure 1. The first 27 nucleotides of 
the gene were included in the synthesized 
primers used to isolate the gene and as such 
do not necessarily represent die true genomic 
sequence and are not included here in calcu- 
lation of identity. All data discussed is based 
on codons 10-366 out of die 375 total codons. 
The total intronic sequence between the start 
and stop codons is 49 nucleotides longer in L. 
cyanellus than L. macrochirus, but it is nearly 
identical otherwise (Figure 2). The majority of 
the differences observed reflect gaps or inser- 
tions and occur within the first intron. The se- 
quence identity for the total sequence is 
94.6%. The presumed amino acid sequence 
has over 95% identity with published protein 
sequences from Oncorhynchus mykiss (John- 
son 2002) and Cyprinus carpio (Liu et al. 
1990). Variation in the coding regions between 
L. macrochirus and L. cyanellus is confined to 
the third position of the codon in most in- 
stances, as expected (data not shown). 

Primers were designed to exploit the differ- 



106 



journal of the Kentucky Academy ol Science 65(2) 



Exon 1 forward primer - 



L.m. ATGGATGATGAAATCGCCGC ACrGG7TG7TGACAACGGA TCCCCTATCT 
L.c. ATGGATGATGAAATTGCCGC ACTGG rrGTrGACAACGGArCCGGrATGr 

GCAAAGCCGGTTTCGCCGGAGACGACGCCCCTCGTGCTGTCTTCCCCTCCATCG 
GCAAAGCCGGTTTCGCCGGAGACGACGCCCCTCGTGCTGTCTTCCCCTCCATCG 

TTGGTCGCCCCAGGCATCAGgtgagtgattgatcgccagcacaataaagccaca 
TTGGTCGCCCCAGGCATCAGgtgagtgattgatcgccagcacaataaagccaca 

ccgtttttta tggattttaaaacacatttactatcc 

ctggtttttaataagaacttgctgattatggattttaatacacatttactgacc 

taattacactcctaagcaattaaaatta ttcctgaatttcttgattgtta 

taattacactcctaaacaattaaaattaattattcctgaatttcttgattgtta 

aatgaaaattgetttget aatgaggtctaaccactaagc 

g c t g a a a a 1 1 g c 1 1 1 g c t ca_tatg_ctg_aca_tctaa_cg_ag_g_tctaacca c t a a g c 

* — L. cyanellus reverse primer 
aacatttacatgcgcaacctgattaaataagtactatattatgggaaatattcc 

aacatttacatgcacaacctaattaaa tactgcattataggaaatattcc 

^ L. macrochirus reverse primer 

ctcattgtatt tgacaca cg tacatqtaqtcaaqa tct ttaccttttaa t 

cacatggtattgccgagacacaaatacatgtagtcaagatcttaaccttt-aat 

taggaactgctacatatccatgttttgttttt aacaagtttgtcttg 

taggaactgctacatagcaatgttctctttttttcttttaacaagtttgtattg 

tttgtcatgtcctgttcagGGAGTGATGGTGGGTATGGGCCAGAAGGACAGCTA 
tttgtCatgtcttgttcagGGAGTGATGGTGGGTATGGGCCAGAAGGACAGCTA 

Figure 1 . The genomic sequence of the beta-actin gene 
in Lepomis macrochirus and L. cyanellus. The exonic se- 
quence is in capital letters, intron 1 is in lowercase letters. 
All of exon 1 and the beginning of exon 2 are shown. The 
locations of primers are italicized. Gaps are indicated by 
dashes in the sequence. 



ences observed in the first intron, particularly 
where gaps were present. PCR amplification 
with the primers indicated in Figure 1 pro- 
duced species-specific products when assayed 
by gel electrophoresis. Figure 3a shows the re- 
sults when the Exon 1 Forward Primer 
(EXIF) was paired with the L. macrochirus 
Reverse Primer (MRP). There are 355 base- 
pair long bands present with L. macrochirus 
DNA (lanes 2—4), absent with L. cyanellus 



1234 56789 



L. macrochirus 




429 




/\ /\ 




\ 123 1 330 


| » | 


I 439 


1 111 [ 182 [ 1 09 | 


144 | 


I 
L. cyanellus 


II 


III 


rv 


V 


1 123 | 373 


| 239 


I 439 
III 


] 111 | 182 J 108 | 


144 | 


I 


II 


IV 


V 



Figure 2. Gene structure of the beta-actin gene in Le- 
pomis macrochirus and L. cyanellus. The nucleotide 
lengths of exons I through V are indicated in boxes and 
the lengths of introns are indicated between the boxes. 
The gene contains four introns between the start and stop 
codons. 5' and 3' untranslated regions are not included 
here. 




Figure 3. PCR products are species-specific. Panel 3a 
shows the results when the "Exon 1 Forward Primer" is 
paired with the Lepomis macrochirus Reverse Primer 
(MRP). The expected product is 355 basepairs long. 
Bands are only present with L. macrochirus DNA (lanes 
2-4) and hybrid DNA (lanes 8-9). Panel 3b shows the 
results when EXIF is paired with the the L. cyanellus 
Reverse Primer (CRP). The expected product is 282 ba- 
sepairs long. Bands are only present with L. cyanellus 
DNA (lanes 5-7) and hybrid DNA (lanes 8-9). Panel 3c 
shows the products of a reaction using EXIF, MRP and 
CRP. Both species exhibit their expected size bands (lanes 
2-4 and 5-7), and the hybrid DNA produces both 282 
and 355 basepair products. 



DNA (lanes 5-7) and present with genomic 
DNA from the hybrid specimens (lanes 8-9). 
Figure 3b shows the results when EXIF was 
paired with the the L. cyanellus Reverse Prim- 
er (CRP). There are 282 basepair long bands 
absent with L. macrochirus DNA (lanes 2-4), 
present with L. cyanellus DNA (lanes 5-7) 
and present with genomic DNA from the hy- 
brid specimens (lanes 8-9). 

The products of a reaction using EXIF and 
both reverse primers simultaneously (MRP 
and CRP) are shown in Figure 3c. In this sce- 
nario, each single species is limited to produc- 



PCR-Based F, Hybrid Screen— Peyton 



107 



ing the specific hand corresponding to its 
chromosomal sequences, hut the hybrid sam- 
ples allow amplification of both the 282 and 
355 hasepair products. It may be pointed out 
that a potential technical limitation is that 
competition for the common primer in each 
reaction (in this case, the forward primer) may 
cause unequal intensity in the resulting bands 
when both templates are present, as in the hy- 
brid. Most likely this could be overcome by 
tedious selection and optimization of primer 
length and GC content, but the unequal in- 
tensity does not interfere with the interpreta- 
tion and is considered unimportant in the final 
result. The fact that both bands are present 
only if both parental versions of beta-actin are 
present is of primary interest here. This limi- 
tation was not a factor in this primer combi- 
nation, but to normalize intensity between sin- 
gle species genomic DNA samples and hybrid 
DN A samples (which contain half of the tem- 
plate amount for each product), 30% more hy- 
brid product was loaded into the gel for anal- 
ysis. 

DISCUSSION 

In this study, I describe a technique for de- 
veloping a rapid and unambiguous test for 
identification of F l hybrid fish. This technique 
is not suitable for determining introgression, 
gene flow, or F 2 crosses. Instead, it should be 
used as a simple identification tool and can be 
rapidly adapted to any species. For example, 
in 10 days or less the sequence data for the 
beta-actin gene can be acquired from a fin bi- 
opsy, and species-specific primers can be syn- 
thesized. Even though the intronic primers 
used here, by design, have limited application 
outside of L. cyanellus and L. macrochirus, 
the consensus primers for the start and stop 
codons have potential for use in any species, 
and could be even more adaptable if the wob- 
ble codon positions were made degenerate in 
the primer design. Preliminary data indicate 
that these primers will not be restricted to the 
centrarchids. At this time, I have already iso- 
lated the beta-actin gene from five esocids us- 
ing these primers and the techniques de- 
scribed herein. Therefore, there is little doubt 
that this technique could have broad applica- 
tion. 

This is also the first description of a Lepom- 
is beta-actin genomic sequence. The predicted 



gene structure appears In have conserved exon 
lengths with other teleosts as distantly related 
as Takifugu rubripes (Venkatesh et al. 199fi) 
and Esox masquinongy (author's observation). 
The amino acid sequence is highly conserved, 
and it is noteworthy to mention that beta-actin 
is a widely used phvlogenetic marker that 
could have potential lor characterizing the re- 
lationships between the Centrarchids as well 
as other families (Baldauf et al. 2000; Bhatta- 
charva and Weber 1997; Coodson and Hawse 
2002). The implications of this will be dis- 
cussed elsewhere when a complete collection 
of Lepomis sequences is obtained. 

ACKNOWLEDGMENTS 

I thank Ben Brammell for his assistance in 
the collection of specimens. This work was 
supported by a grant from the Institute for 
Regional Analysis and Public Policy at More- 
head State University. 

LITERATURE CITED 

Avise, J. C, and N. C. Saunders. 1984. Hybridization and 
introgression among species of sunfish (Lepomis): anal- 
ysis by mitocbondrial DNA and allozyme markers. Ge- 
netics 108:237-255. 

Baldauf, S. L., A. J. Roger, I. Wenk-Siefert, and W. F. 
Doolittlc. 2000. A kingdom-level phylogeny of eukary- 
otes based on combined protein data. Science 290:972- 
977. 

Bhatlaeharya, D., and K. Weber. 1997. The actin gene of 
the glaucocystophyte Cyanophora paradoxal analysis of 
the coding region and introns, and an actin phylogeny 
of eukaryotes. Curr. Genet. 31:439-446. 

Childers, W. F. 1967. Hybridization ot four species of sun- 
fishes (Centrarchidae). Illinois Nat. Hist. Surv. Bull. 92: 
159-214. 

Goodson, H. V., and W. F. Hawse. 2002. Molecular evo- 
lution of the actin family. J. Cell Sci. 115:2619-2622. 

[ohnson, M. C. 2002. Direct submission of Oncorhynais 
mykiss sequence to GenBank. Accession no. AJ43815S. 

Lee, J. S., and M. C. Gye. 2001. Use of beta-actin gene 
nitron 2 as a phylogenetic marker in fish taxonomy 
DNA Sequence 12:71-76. 

Liu, Z. J., Z. Y. Zhu, K. Roberg, A. Faras, K. Guise, A. R. 
Kapuscinski, and P.B. Hackett. 1990. Isolation and char- 
acterization of beta-actin gene of carp (Cyprians car- 
pio). DNA Sequence 1:125-136. 

Neff, B. D. 2001. Genetic paternity analysis and breeding 
success in bluegill sunfish (Lepomis macrochirus). J. 
Hered. 92:111-119. 

Venkatesh, B., B. H. Tay, G. Elgar. and S. Brenner. 1996. 
Isolation, characterization and evolution ol nine puller- 
fish (Fugii nibripes) actin genes, f. Molecular Biol. 259: 
655-665. 



J. Ky. Acad. Sci. 65(2): 108-1 15. 2004. 

Growth of Stygobitie (Orconectes australis packardi) and Epigean 

(Orconectes cristavarius) Crayfishes Maintained in 

Laboratory Conditions 

Ann-Simone Cooper and Robin L. Cooper' 
Department of Biology, University of Kentucky, Lexington, Kentucky 40506-0225 

ABSTRACT 

This study reports on maintenance and growth of the cave crayfish, Orconectes australis packardi, and 
the epigean crayfish, Orconectes cristavarius, within laboratory conditions for 1 and 2 years. The O. a. 
packardi survived well compared to the O, cristavarius in captivity. The poor survival of the epigean species 
was probably due to unsuitable conditions. The epigean as well as the cave crayfish molted and grew in 
captivity, but without any significant difference in molt frequency between species. In the first year, total 
body length was obtained to assay growth, whereas in the second year the more accurate measure of post- 
orbital carapace length was used. The ability of O. a. packardi to adjust to captivity is likely due to their 
lower metabolic rate and ability to handle hypoxic stress better dian epigean species. 



INTRODUCTION 

The growth and maintenance of cave cray- 
fishes in laboratory conditions is not well doc- 
umented but advantageous to know for several 
reasons. Although field studies may inform us 
of those aspects of growth that occur in na- 
ture, they are complicated by many variables 
that cannot be controlled. For instance, with 
respect to crustaceans as well as mammals, pe- 
riodic climate changes over a yearly cycle or 
over several years can bias data obtained dur- 
ing a brief period of time. This is also relevant 
for cave crustaceans that are influenced by 
surface streams varying seasonally in temper- 
ature. Resources, such as food and shelter, 
also may impact one subset of the population 
but not another (e.g., location dependent), as 
is known to occur in sand crabs (Siegel and 
Wenner 1985). Standardization of such vari- 
ables in controlled laboratory studies allows 
them to be assessed and tested for integration 
in field studies. In addition, knowledge of how 
well stygobitie (i.e., aquatic cave obligate) an- 
imals survive in a holding facility is of use in 
case of a need to temporarily circumvent spe- 
cies eradication by acute environmental im- 
pacts. Such disturbances occur with land de- 
velopment, producing a high sedimentation 
and anthropogenic pollutants known to be le- 
thal to crustaceans in general (Fingerman 
1985). 

Growth measurements of stygobitie cray- 



1 To whom correspondence should be addressed. 



fishes in the field have proven to be a difficult 
task, and this is likely the reason for the scar- 
city of quantitative data. Problems of marking 
and recapture of cave crayfish species over the 
molt cycle have been addressed by Cooper 
(1975), Cooper and Cooper (1976), Hobbs III 
(1978), and Weingartner (1977). Using various 
marking approaches, individuals have been re- 
captured and identified for 5 years in one 
study (Cooper 1975), 3.5 years by Weingartner 
(1977), and 2 years in another study (Hobbs 
III 1973). Recapture studies of troglophilic 
crayfish (Cambanis laevis Faxon) over a year 
and ones maintained in jars held within sur- 
face and cave streams were conducted by 
Weingartner (1977). 

Field monitoring of crustacean develop- 
ment in a variety of karsts with wide-ranging 
dynamics is necessary since water tempera- 
ture, environmental space, and food resources 
are not constant within all karst systems. Sur- 
face stream runoff from summer to winter al- 
ters water temperature in caves. For example, 
karst waters in an Indiana cave varied from 
11.6 to 8.0°C after a rain on a snow-laden sur- 
face (Poulson 1964). In the second longest 
cave in Kentucky (Coral Cave, 38.46 km of 
passages) and die third longest (Sloans Valley 
Cave, 37.70 km of passages), both in Pulaski 
County, stygobitie crayfish (Orconectes aus- 
tralis packardii Rhoades, 1944), occur within 
a short distance of a karst window (30 m in 
Coral Cave) and are exposed to fluctuating wa- 
ter temperatures. In contrast, the longest cave 



108 



Laboratory Growth <>l Cave and Surface Crayfishes — Coop 



(I Cot 



per 



KM 



in Kentucky (Mammoth Cave, Edmonson 
County, 580 km ol passages) contains deep 
bodies of water with little variation in temper- 
ature as well as regions more directly influ- 
enced hv surface stream temperatures (Barr 
and Kuelme 1971; Packard INNS; Poulson 
1992). Since water temperature is the major 
environmental trigger for inducing molting in 
cave crayfishes (Jegla 1966, 1969), one would 
expect crayfish populations within caves to 
have varied molt cycles. Thus, growth rates of 
crayfishes may vary depending on the region 
of a cave in which the animals are being mon- 
itored. Estimates of age and developmental 
rates of cave crayfishes suggest that they de- 
velop very slowly and that some can live for 
long periods (—30 years) (Cooper 1975; Coo- 
per and Cooper 1978; Weingartner 1977), but 
direct measurements over this long have not 
been made. In addition, since temperature is 
a regulating environmental factor in crusta- 
cean development, generalizations for all cave 
crayfishes are impractical since the animals in- 
habit various physiomorphic regions of caves. 
Here we report on a preliminary study to 
monitor the growth and laboratory mainte- 
nance of a stygobitic species (Orconectes aus- 
tralis packardi Rhoades, 1944) and an epigean 
(surface-dwelling) species (Orconectes crista- 
varius Taylor, 2000). We used both juvenile 
and mature crayfish so we could determine if 
various age groups would survive in controlled 
conditions. In this preliminary study, we re- 
port on the laboratory conditions used and the 
growth of these species maintained over a 1- 
year and in some cases a 2-year period in a 
defined laboratory setting. 

MATERIALS AND METHODS 

Orconectes a. packardi were collected in 
the Sloans Valley Cave System at die "Appa- 
lachian Trail" in a pool of water measuring 3 
m wide, 6 m long, and at most 0.3 m deep. 
Orconectes cristavariiis were obtained from a 
relatively fast-moving surface stream (Four- 
mile Creek) by Fourmile Road in Clark Coun- 
ty, KY. Species identification was confirmed by 
Dr. Gunther Schuster of Eastern Kentucky 
University for O. cristavarius and by the tax- 
onomic key provided in Hobbs Jr. et al. (1977) 
for O. a. packardi. 

The crayfishes were transported to the lab- 
oratory in Lexington, KY, in water obtained 



from their environment. They were then 
transferred to individual aquaria (33 X 28 X 

23 cm; water deplli 10—15 cm) and held as 
isolates throughout the study. Some individu- 
als were housed successfully for a year. Con- 
tainers were cleaned biweekly and animals 

were led with c< ercial lish food pellets 

(Aquadine), which is marketed as "shrimp and 
plankton sticks: sinking mini sticks." Since lliis 
consists of ground-up fish it would appear to 
be a suitable and nutritious diet for crayfishes. 
Fragments of cleaned chicken egg shell also 
were placed in the containers as a source of 
calcium. The chloramines Lexington uses for 
water purification were removed by carbon- 
based filters for the aquaria water. The car- 
bon-filtered water was held in a 190 liter (50 
gallon) plastic tank and aerated for several 
days before utilization. Bacteria and algae 
were allowed to grow in the tank in order to 
detoxify any NH 4 + and convert it to nitrite and 
nitrate, since NH., + is known to be toxic to 
crustaceans (McRae 1999). Cave animals were 
maintained in total darkness except for feed- 
ing, cleaning, and measuring. Epigean animals 
were exposed to a low light level widi a light 
cycle of 16:8 (light: dark) produced by full 
spectra lights (General Electric). When the 
aquaria were cleaned or when measurements 
were obtained, observations were made if the 
animals had molted by the appearance of the 
animal and by the presence, in the holding 
tank, of the chelae from the old exoskeleton. 
Neither species would fullv consume the che- 
lae after they consumed the rest of the old 
exoskeleton. The temperature was maintained 
at 16 to 17°C throughout the year; this was 
the temperature of the laboratory. At one pe- 
riod the laboratory temperature was uncon- 
trolled as mentioned in the results during the 
second year of this study. Aquaria for both the 
surface and cave species were stored in the 
same room over the same period ot time, and 
the tanks containing the cave species were 
covered with black plastic to Mock light. 
Aquaria were marked with numbers so that 
individuals could be monitored. 

Total body length (tip of rostrum to the end 
of telson) was measured to an accuracy ot 1 
millimeter with a flexible plastic ruler. Mea- 
surements were obtained lour times during 
the first year. Alter the first year we learned 
thai thi' total body length measure is likely in- 



110 



Journal of tlie Kentucky Academy of Science 65(2) 



accurate because of the flexibility of the joint- 
ed abdomen. So for a subsequent year of hold- 
ing some of the same crayfishes in captivity, 
along with the addition of new individuals, the 
postorbital carapace length (from the posteri- 
or, dorsal surface of the orbital cup to the end 
ol the carapace directly posterior to die eye 
cup) was used. These measures were made 
with calipers (Swiss Precision, Switzerland, 0.1 
mm). As for the first-vear study, four different 
time points were used throughout the year. A 
similar periodic sampling had previously been 
used by Weingartner (1977). The percent 
growth was determined by: [(postmolt length 
— premolt length)/(premolt lengdi)] X 100. 

RESULTS 

The epigean and stygobitic species grew 
and molted in captivity, but the survival rate 
over die first and second years was lower for 
the epigean species than for the stygobite. The 
highest mortality for the epigean species oc- 
curred after 7 mondis, although two of them 
died after 4 mondis. The stygobitic species 
demonstrated a better survival rate, with onlv 
one dying after 4 months and another after 9 
months. The one that died at 4 mondis ap- 
peared to do so during ecdysis since the exu- 
vium was still attached to the body. The indi- 
viduals diat died are represented in Figure 1 
as line plots that do not fully extend to the 
end of 1 or 2 years. The lines terminate at the 
period when measurements were last ob- 
tained. 

The frequency of molting was substantially 
higher (9 of 12 animals) for the epigean spe- 
cies within die first few months of contain- 
ment. A second molt was noted for only one 
of the epigean species within the first 12 
months (Figure IB, note two asterisks). Of the 
four surface crayfish tiiat progressed to die 
second year of study onlv die largest one died. 
Three of the 13 stygobites molted during die 
same first few mondis and two of diem after 
9 months. The individuals that molted are in- 
dicated widi asterisks witiiin the period of 
time a molt was noted (Figure 1). Only in die 
stygobitic species was it observed that some 
individuals actually had a reduction, instead of 
an increase, in their body length after a molt. 
This phenomenon has also been reported for 
O. a. australis by Cooper (1975), and in an 
earlier report Creaser (1934) stated that in the 



A 



Oap 



6.0 

E 5.5 
-c 5.0 



S 4.5 

f 4.0 
CD 



3.5 - 
3.0 




100 



— 1 — 
200 



300 



— 1 
400 



B 



7.5 

7.0 



E 6.5 - 
o 

^ 6.0 - 
c 5.5- 

0) 

t. 5.0- 
£ 4.5 H 

4.0 - 

3.5 



O.c. 




25^ 



100 



200 
Days 



300 



400 



Figure 1. Growth of stygobitic (Orconectes australis 
packardi) and epigean (Orconectes cristavarius) crayfishes 
in laboratory conditions. Growth curves were obtained by 
measures of total bodv length of the animals maintained 
as isolates (A) Orconectes australis packardi (O.a.p.) and 
(B) Orconectes cristavarius (O.c.) for a 1-year period in 
captivity. Asterisks denote that a molt occurred in that 
time period. Individuals diat died have their growth plot 
terminated at the last date a measurement was taken. 
There was substantial mortality for the epigean O.c. spe- 
cies after 7 mondis of containment. Initially N = 13 for 
O.a.p. and N = 12 for O.c. 

crayfish O. propinquus (Creaser used the 
name Faxonius propinquus) growth was not 
always associated with a molt when the male 
changed in sexual form. We are fairly confi- 
dent in the recorded dates of molts for each 
animal; however, there were a few animals, in 
both species, that indicated a growth in body 
length without a molt being observed. This 
lack in changes of lengtii we account to not 
being able to fully stretch the abdomen of the 
animal consistently during all measures. Per- 
haps the muscles between the segments of the 
abdomen were relaxed more during some 



Laboratory Growth ol Cave and Surface Crayfishes — Cooper mid ('oojicr 



11 



measures than others. This problem was 
avoided during the second year ol this study 
in which the postorbital carapace length was 
measured. 

Four freshly caught stygobites were added 
to the study for the second year because we 
released a tew from the first-year study back 
in the cave since we clipped one pair of an- 
tennules from some individuals at the end of 
the first-vear study to aid in another study in 
antennule growth within a molt cycle. Figure 
2A contains the data obtained during the sec- 
ond year of the study of the stygobites. The 
ones in the graph depicted with circles were 
from the first-year studv and the ones repre- 
sented by triangles were crayfish newly added 
to the study. The results obtained in the sec- 
ond year indicate that the animals did increase 
in length during a molt although a minor 
amount in some cases. For the stygobites, 
three out of die four added to the study in the 
second year molted within the first 2 months. 
Six out of the eight molted within the last 150 
days, which was likely a result of the labora- 
tory having environmental temperature swings 
for a period of about 2 weeks with tempera- 
tures reaching as high as 28°C. 

The few- epigean crayfish appeared to in- 
crease in size to a greater degree than die sty- 
gobitic species. As in Figure 2A, the lines in 
Figure 2B depicted with circles were ones 
from the first-year studv, and the crayfish rep- 
resented bv triangles were newly added epi- 
gean species. Only three animals were carried 
over from the first-year study. One died within 
1 month, another within 3 months, and the 
last one within 7 months of the second studv 
in which postorbital carapace length was mea- 
sured. As in the first-year studv; the newly 
added epigean crayfish also showed a low re- 
sistance to laboratory rearing since a good 
number had died before the year was com- 
pleted. 

To determine die extent of die difference 
in growth between the two species during the 
first year of the studv. a percent change for 
each individual was determined and the 
means of the percent differences were com- 
pared between species (Figure 3A,). Since so 
many animals died in the epigean population 
in the period between 220 days and 365 davs, 
the 220-dav measurement session was used to 
calculate the percent difference in growth for 



0) 

o 
<o 

Q._ 

2 E 
ro p 
o i. 

ro S 

-£ <= 
o & 

Vi 
o 
o. 



30 -i 



28 

26 
24 
22 
20 
18 
16 



O.a.p 




— i — 
100 



200 



300 



400 



B 



0) 

o 

ro 

H 

ro£ 

■P c 

o-2> 



32 

30 
28 
26 
24 
22 
20 
18 
16 
14 



Oc. 




— i — 
100 



1 — 

200 

Days 



300 



400 



Figure 2. Growth curves of stygobitic (Orconectes aus- 
tralis packardi) and epigean (Orconectes cristavarius) 
crayfishes as measured by postorbital carapace length. 
Plots for Orconectes australis packardi (O.a.p.) (A) and 
Orconectes cristavarius (O.c.) (B) are shown. Animals 
held throughout a second vear in captivity (solid circles) 
as compared to 1 year (solid triangles) are indicated. As- 
terisks denote that a molt occurred in that time period. 
The indhiduals that died have their growth plot termi- 
nated at the hist date a measurement was taken. As in the 
first vear of studv, diere was again high mortality for O.c. 
No O.c. survived for 2 years in captivity. Initially N = 13 
for O.a.p. and N = 12 for O.c. 



this species during the first vear. Most of the 
growth for the epigean species occurred ear- 
lier than that for the stygobitic species. As 
mentioned earlier, the total body length was 
likely subject to error, but since such measures 
of surface crayfish species are rapidly made for 
aquaculture purposes, we retained these data 
since they can be of use. The growth measures 
during the second vear for the stygobitic and 
epigean crayfishes of the postorbital carapace 



112 



il of the Kentucky Academy oi Science 65(2) 



were also compared as a mean of a percent 
change (Figure 3B L 

One group of stvgobite crayfish was used for 
comparison of postorbital carapace length to 
total bodv length (Table 1). The postorbital 
carapace length accounts for about 40% of the 
total body length. The percent in the increase 
of growth, as measured bv postorbital cara- 
pace length, is ca. 9% (Table 2). There did not 
appear to be a correlation with size of the an- 
imal and the percent increase in growth within 
a single molt. 

DISCUSSION 

The results of this studv demonstrate that 
O. a. packardi can be maintained well in cap- 
thitv under defined conditions for up to 2 
vears. This was the case for both small and 
large cra\fish. However, O. cristavarius ini- 
tially showed a good survival rate, which de- 
clined rapidlv die longer diey were housed, 
particularlv after 7 months. Since small and 
large epigean cra\-fish died, the failure to sur- 
vive was probablv due to unsuitable conditions 
for this species within the laboratory rather 
than to senescence. This studv also demon- 
strated that the epigean as well as the cave 
cra\fish molted and grew in captivity. One ap- 
proach to measure growth rates in crustaceans 
is to measure the time from one molt to the 
next in addition to size increases resulting 
from each molt. Only some of die cra\fish we 
held molted a second time (Table 3). Based 
on die molt frequency, diere is little or no dif- 
ference in growth rate between the two spe- 
cies, with O. a. packardi having slightly more 
second molts. In some cases where a molt was 
documented the cave animals did not show 
more dian a few millimeters increase in bodv 
length as assessed during the first year of studv 
bv total bodv lengtii. With measures of post- 
orbital carapace length, as used in die second 
year of studv. an approximate increase in 
lengtii widi each molt is 9%, but there is con- 
siderable individual variation (Table 2). 

Preliminary growth studies widi die stygo- 
bitic crayfish Orconectes inermis inermis Cope 
1872. in Pless Cave, Indiana, using a mark- 
and-recapture approach, indicated diat juve- 
niles showed larger increments of growth at 
ecdvsis than mature animals (Hobbs III 1976). 
Using repetitive recaptures of hundreds of 
marked individuals of three species of stygo- 



£ 8 



CO 

c 



220 Days 



A 2 




8 - 



730 Days 
I 



B 



Q. — 
t- <1> 

.E o 



20 -, 

18 

16 

14 

12 - 

10 

8 

6 - 

4 - 

2 





O.a.p. 
356 Days 

_L_ 



O.c. 



O.a.p 




O.a.p. 



O.c. 



Figure 3. Comparisons in the growth between stvgobitic 
(Orconectes australis packardi) and epigean (Orconectes 
cristavarius) cra\"fishes. (A,) During the first vear of studv 
in which die total body lengths were used, a comparison 
in percent of growth between Orconectes cristavarius 
(O.c.) and Orconectes australis packardi (O.a.p.) is shown 
(N = 13 for O.a.p. and N = 10 for O.c). Since so manv 
O.c. died, die values obtained after 220 days were used 
for both species. The error bars represent die ± of the 
standard error of the mean. (A,) The percent of growdi 
for O.a.p. based on total bodv lengtii, is shown after a 2- 
vear period in captivity. Since no O.c. survived for 2-vears 
a comparison could not be made. (B) In die second vear 
of studv the postorbital carapace lengtii was used as an 
index of growth (N = 8 for O.a.p. and N = 3 for O.c). 
The sample size is smaller for O.c. because of die lack in 
survival of this species. 



bitic cra\"fish in Shelta Cave, Alabama, Cooper 
(1975) predicted that one of die species, Or- 
conectes australis australis (Rhoades 1941), 
might five for 30 years or more. This was 
based on knowTi minimum size at recruitment, 
maximum size, and growdi increments ob- 
served following molts (Cooper and Cooper 
1978, 1979: Culver 1982, p. 51). Detailed 
growth studies over a 1-year period of Cam- 
barus laevis from epigean groups as well as 
groups diat lived widiin die cave were con- 
ducted widi recapture techniques. From such 
measures, growth curves were established 
(Weingartner 1977). In Wemgartner's study a 



Laboratory Growth of Cave and Surface Crayfishes — Cooper and Coopi i 



113 



Talilr I. Comparison of total liody length to postorliital 
carapace length for Oreonietis anstralis packardi. Tuo ad- 
ditional animals not used in the growth studies were used 
for these morphometric measures. 



Table 2. The percent change in POL within .1 moll fc 
Oreonectes australis packardi. 



Premoll (n 





Total body 


Postorbitnl carapace 


Ratio 






length (1 


length (POL) (mm) 


body/POL 






43 


16 


0.37 






44 


IS 


0,11 






47 


17.5 


0.37 






50 


20 


0.40 






51 


20 


0.39 






55 


22.5 


0.41 






58 


19 


0.33 






60 


23 


0.38 






fid 


23.5 


0.39 






71 


29 


0.41 






71 


28 


0.39 




Mean 






0.39 


Mean 


SEM 






0.024 


SEM 



17.1 
17.5 
18.0 
18.2 
LS.3 
19.0 
20.0 
20.5 
21.0 
22.8 
23.5 
26.4 
27.0 
28.0 



■ si Il 'II 



ISO 

L9.1 

20.0 
20.0 
20,5 
21.0 
22.2 
22.1 
23.0 
23,5 
25.3 
28.0 
29.0 
30.0 






5.26 

9 I 1 
II. 1 
9.S9 
12.02 
10.53 
11.0 
7.8 
9.52 
3.07 
7.06 
3.06 
7.41 
7.14 

8.4 

0.7 



few animals were recaptured after 3 vears and 
the growth curves were extended for that 
length of time; however with only a few ani- 
mals the variability was not able to be assessed 
for differences in the age of the animals. 

Poor survivorship for O. cristavarius in our 
studies is likelv a species-dependent phenom- 
enon, since anodier epigean crayfish, Procam- 
barus clarkii (Girard 1852), from Raceland, 
Louisiana, survived well in die same labora- 
tory conditions for 2 vears or more. The rea- 
son for the difference in survival between 
these two epigean species mav be a result of 
emironmental adaptation, since O. cristavar- 
ius is predominantly found in fast-moving, 
highly oxygenated streams, and P. clarkii 
comes from swamps. It might be that die P. 
clarkii and O. a. packardi can survive well in 
water that is not highly oxygenated, such as 
that used in our laboratory, while O. crista- 
varius cannot. It is known that P. clarkii is ver\ - 

J 

hardy and can tolerate all but the severest cas- 
es of hvpoxia (McClain 1999). There might 
also be dietary factors that we did not inves- 
tigate to account for die survival differences. 
All crayfishes held in captivity were fed die 
same diet at the same time. In addition, larger 
animals had a greater quantity of food provid- 
ed to them. 

Stygobitic crayfishes also show an amazing 
resistance to experimentally induced fluctua- 
tions in temperature, from freezing in blocks 
of ice to rapid exposure of high temperature 
(32.5°C) (Park et al. L941). In addition, they 



are known to be starvation resistant, possibly 
due to a lower metabolic rate (Dickson and 
Franz 1980; Dickson and Giesy 1982). Bur- 
banck et al. (1948) and Jegla (1964) both re- 
ported diat cave crayfish have a lower meta- 
bolic rate as compared to epigean species. 
Comparable studies on O. cristavarius are 
lacking, so it remains unknown if this species 
can tolerate general stress as well as P. clarkii 
and O. a. packardi. 

The differential in the initial growth rate 
between O. cristavarius and O. a. packardi is 
interesting. It is possible that the handling, 
transport, and exposure to a new environment 
are factors, although care was taken not to al- 
low the animals to heat up in transport or be 
exposed to fluctuating temperature. However, 
a change in temperature from a surface 
stream or cave could have an impact on the 
initial molting frequency. Temperature is con- 



Table 3. Comparison of growth rates by frequency of 
molts within the first and second years of captivity for 
Oreonectes australis packardi and Oreonectes cristavarius 
crayfishes. 





1st molt 


2nd molt 


Isl year 






O.a.p. 
O.e. 


5 of 12 animals 
LOol 12 animals 


none 

1 of 4 


2nd year 






0.a.p. 

O.e 


14 of S animals 
10 of 9 animals 


5 of 8 animals 

3 11I 3 animals 



114 



ial of the Kentucky Academy <>l Science 65(2) 



sidered to be one of the most significant lac- 
tors in regulating crustacean growth (Conan 
1985): not only an increase in water temper- 
ature but a reduction as well can induce molt- 
ing. Other small crustaceans, such as copepods 
(Vidal 1980) and amphipods (Dagg 1976), re- 
duce their molt frequency in cold tempera- 
tures, but when this occurs the animals grow 
larger after each molt than when they molt 
more frequently. In contrast, an increase in 
temperature can inhibit some crustaceans 
from molting (Haefner and van Engle 1975). 
The shrimp Crangon crangon Linnaeus is 
known to have varied longevity depending on 
environmental temperature (Labat 1977; 
Llyod and Yonge 1947; Oh 1999). For a review 
of factors regulating growth in crustaceans see 
Wenner (1985). 

The increase in initial growth of O. crista- 
varius is not likely due to 'catch-up' growth, 
common in crustaceans when they are ex- 
posed to sufficient food after being deprived 
of food (Bostworth and Wolters 1995), since 
the habitat from which they were obtained 
was abundant in crayfish, fish, and snails as 
dietary resources. On the other hand, the lack 
of growth for O. a. packardi even after a molt 
might be expected since it has been reported 
that an O. a. australis measuring 35.2 mm in 
total carapace length did not alter its length 
after two molts (Cooper 1975). It would be of 
value to know if stygobitic crayfish do show 
'catch-up' growth depending on resources, or 
if the growth attained for a molt is tempera- 
ture regulated. If such growth does occur it 
would make it difficult to determine the cor- 
rect age of adult animals without knowing 
their complete life history and environmental 
conditions. This is particularly relevant since 
Weingartner (1977) showed differential rates 
of growth within various regions in a single 
cave system. It was concluded that the envi- 
ronmental differences in water temperature 
and food resources likely accounted for the re- 
gional differences. 

It is our hope that one will consider the pos- 
sibility of long-term rearing of crayfishes in 
suitable laboratory conditions to gain insight 
into environmental factors regulating the de- 
velopmental issues and to further refine lab- 
oratory conditions that promote survival. 



ACKNOWLEDGMENTS 

We thank Richard M. Cooper for his help 
with feeding and maintaining the Crayfish; 
John LaMar Cole and Dr. Milan L. Hopper 
(University of Kentucky) for help in obtaining 
cave crayfish and bearing with us on the time- 
consuming cave expeditions in the Sloan's Val- 
ley Cave System where die cave crayfish were 
obtained; and Hyewon Cooper and the Kim 
family of Lexington for helping to obtain epi- 
gean crayfish. Editorial assistance was provid- 
ed by Austin M. Cooper. 

LITERATURE CITED 

Barr, T. C, Jr., and R. A. Kuehne. 1971. Ecological studies 
in the Mammoth Cave system of Kentucky II. The eco- 
system. Annales Speleol. 26(l):47-96. 

Bostworth, B. G., and W. R. Wolters. 1995. Compensatory 
growth in juvenile red swamp crawfish, Procambarus 
clarkit. Pages 64S-656 in R. P. Romaire (ed). EighrJi 
International Symposium on Astacology. Louisiana 
State University, Baton Rouge, LA. 

Burbanek, W. D., J. P. Edwards, and M. P. Burbanck. 
1948. Toleration of lowered oxygen tension by cave and 
stream crayfish. Ecology 29:360-367. 

Conan, G. Y. 1985. Periodicity and phasing of molting. 
Pages 73-99 in A. M. Wenner (ed). Crustacean issues 
3, Factors in adult growth. AA. Balkema, Boston, MA. 

Cooper, J. E. 1975. Ecological and behavioral studies in 
Shelta Cave, Alabama, with emphasis on decapod crus- 
taceans. Ph.D. Thesis. University of Kentucky, Lexing- 
ton, KY. 

Cooper, J. E., and M. R. Cooper. 1976. Marking crayfish 
for long-term ecological studies. ASB Bull. 23(2):52. 
[abstract]. 

Cooper, J. E., and M. R. Cooper. 1978. Growth, longevity, 
and reproduction strategies in Shelta Cave crayfishes. 
NSS Bull. 40(3):97. [abstract]. 

Cooper, J. E., and M. R. Cooper. 1979. Growdi, longevity, 
and reproduction strategies in Shelta Cave crayfishes. 
Page 85 in E. Werner (ed). Proceedings of the 1977 
National Speleological Society Annual Convention, Al- 
pena, MI. 

Cope, E. D. 1872. On die Wyandotte Cave and its fauna. 
Am. Naturalist 6:406-422. 

Creaser, E. P. 1934. Age, growdi, and sex ratios in die 
crayfish Faxonius propinquus. Trans. Michigan Acad. 
Sci. 14:581-585. 

Culver, D. C. 1982. Cave life: evolution and ecology. Har- 
vard Univ. Press, Cambridge, MA. 

Dagg, M. J. 1976. Complete carbon and nitrogen budgets 
for the carnivorous amphipod, Calliopus laeviusculus 
(Kroyer). Int. Rev. Ges. Hydrobiol. 61:297-357. 

Dickson, G. W, and R. Franz. 1980. Respiration rates, 
ATP turnover and adenylate energy charge in excised 



Laboratory Growth ol Cave and Surface Crayfishes — Cooper and ('nop 



I 



gills of surface and cave crayfish. ( !omp. Biochem, Phy- 
siol. 65 A:375-379. 
Dickson, C. W., and J. P. Giesy. I9S2. The effects of star- 
vation on muscle phosphoadenylate concentrations and 

adenylate energy charge of surface and cave crayfish. 
Comp. Biochem. Physiol. 71 A:357-361. 

Fingerman. S. W. 1985. Non-metal environmental pollut- 
ants and growth. Pages 219-234 in A. M. W'enner (ed). 
Crustacean issues 3, Factors in adult growth. AA. Bal- 
kema, Boston, MA. 

Girard, C. 1852. A revision of the North American Astaci, 
with observations on their habits and geographical dis- 
tribution. Proc. Acad. Nat. Sci. Philadelphia 6:87-91 

Ilaefner, P. A., Jr., and W. A. van Engel. 1975. Aspects of 
molting, growth and survival of male rock crabs Cancer 
irroratus, in Chesapeake Bay. Chesapeake Sci. 16:253- 
265. 

Hobbs, 11. 11.. Jr., II. 11. llobbs. III, and M. A. Daniel. 
1977. A review of the troglobitic decapod crustaceans 
of die Americas. Smithsonian Contrib. Zool. 244:1-183. 

Hobbs, II. II., III. 1973. The population dynamics of cave 
crayfishes and their commensal ostracods from south- 
ern Indiana. Ph.D. Thesis. Indiana University, Bloo- 
mington, IN. 

Hobbs, H. II., III. 1976. Molt cycle, size and growth in 
Orconectes inermis inermis Cope (Decapoda: Cambar- 
idae). Virginia J. Sci. 27:44. [abstract]. 

Hobbs. II. II., III. 1978. Studies of the cave crayfish, Or- 
conectes inermis inermis Cope (Decapoda, Cambari- 
dae). Part IV: Mark-recapture procedures for estimating 
population size and movements of individuals. Int. J. 
Speleol. 10:303-322. 

Jegla, T. C. 1964. Studies of die eyestalk, metabolism, and 
molting and reproductive cycles in a cave crayfish. 
Ph.D. Thesis. University of Illinois, Champaign, IL. 

Jegla, T. C. 1966. Reproductive and molting cycles in cave 
crayfish. Biol. Bull. 130:345-358. 

Jegla. T. C. 1969. Cave crayfish: Annual periods of molting 
and reproduction. Actes du IV' Congr. Int. Speleol. Yu- 
goslavie (12-26 IX 1965) 4-5:135-137. 

Labat, J. P. 1977. Ecologie de Crangon crangon (L.) (De- 
capoda, Caridea) dans un etang de la cote langue-do- 
cienne. Vie et Millieu 30, ser. A:232-292. 

Llvod, A. J., and C. M. Yonge. 1947. The biology of Cran- 
gon vulgaris L. in the Bristol channel and Severn es- 
tuarv. J. Mar. Biol. Assoc. United Kingdom 26:626-661. 

McClain, VV. R. 1999. Effects of hypoxia on growth and 



survival ol the crayfish Procambams clarkti. Freshwater 
Crayfish 12:121 L33 

MeRae. T. L999. Chemical removal of nitrite and chlori- 
nating agents froi unicipal water supplies used lor 

crayfish and aquarium finfish culture. Freshwatei ( Iraj 
fish 12: 727-732. 

oli. C.-W. 1999. Life history and population dynamics ol 
the crangonid shrimps Crangon crangon and PhUoch- 
eras trispinosus in Port Erin Bay. Isle of Man. Ph.D. 
Thesis. University of Liverpool, Liverpool, UK. 

Packard. A. S. 1888. The cave fauna of North America 
with remarks on the anatomy of the brain and origin of 
the blind species. Mem. Natl. Acad. Sci. 4(1):] 156, 26 
plates. 

Park, O.. T. W. Roberts, and S. J. Harris. 1941. Prelimi- 
nary analysis of activity of the cave crayfish, Cambarus 
pellucidus. Am. Naturalist 75:154-171. 

Poulson, T L. 1964. Animals in aquatic environments: an- 
imals in caves. Pages 749-771 in D. B. Dill, E. F. 
Adolph, and C. G. Wilber (eds). Handbook of physiol- 
ogy. Section 4, Adaptations to the environment. Wil- 
liams and Wilkins Co., Baltimore, MD. 

Poulson, T. L. 1992. The Mammoth Cave ecosystem. Pag- 
es 569-611 in A. I. Camacho (ed). The natural history 
of biospeleology. Monogr. Natl. Mus. Nat. Sci. Madrid. 

Rhoades, R. 1941. Notes on some crayfishes from Ala- 
bama caves, widi the description of a new species and 
a new sub-species. Proc. U.S. Naturalist Mus. 91:141- 
148. 

Rhoades, R. 1944. The crayfishes of Kentucky. Am. Midi. 
Naturalist 31:111-149. 

Siegel, P. R., and A. M. Wenner. 19S5. Field and labora- 
tory studies of sand crab growth. Pages 165-170 in A. 
M. Wenner (ed). Crustacean issues 3, Factors in adult 
growdi. AA. Balkema, Boston, MA. 

Taylor, C. A. 2000. Systematic studies of the Orconectes 
juvenilis complex (Decapoda: Cambaridae), with de- 
scriptions of two new species. J. Crust. Biol. 20:132- 
152. 

Vidal, J. 1980. Phvsioecology of zooplankton I. Effects of 
phytoplankton concentration, temperature, and body 
size on the growth of Calanus pacificus and Pseudoca- 
lanus sp. Marine Biol. 50:111-134. 

Weingartner, D. I. 1977. Production and tropic ecolog) "I 
two crayfish species cohabiting an Indiana cave. Ph.D. 
Thesis. Michigan State University, East Lansing. Ml 

Wenner, A. M. 1985. (ed). Crustacean growth: Factors in 
adult growth. Crustacean issues 3. AA. Balkema, Bos- 
ton, MA. 



J. Ky. Acad Sd 65 2 :116-131. 2004. 

Vascular Flora of Five Reservoirs in the Berea College Forest, 
Madison and Jackson Counties, Kentucky 

Ralph L. Thompson 

Herbarium. Biologv Department. Berea College, Berea, Kentucky 40404-2121 

and 
Chris A. Fleming 

Department of Botany, University of Tennessee, Knoxville, Tennessee 37996-1100 

ABSTRACT 
A descriptive survey of the vascular plants from wetland and aquatic habitats of the five Berea College 
reservoirs, Madison and Jackson counties, in south-central Kentucky was conducted during the growing 
seasons of 1995, 1996, 1998, and 2003. Six plant habitats described are Vegetated Open Water, Emergent 
Marsh, Shrub Swamp. Seasonally Dewatered Mud and Sandflat, Sedge-grass Meadow, and Shallow' Stream 
with Gravel Bar. Relative abundance values were determined for every taxon at each reservoir. The species 
list comprises 292 species, 175 genera, and 65 families. Thirty-eight taxa (13%) are exotics. Species are 
classified as Lycopodiophyta (1). Equisetophyta (2), Polypodiophyta (7), Pinophyta (1), and Magnolioph\ta 
(2S1). In the National Wetland Classification, 205 species (70.0%) are obligate, facultative wedand. and 
facultative species. 



INTRODUCTION 

The Berea College Forest (BCF) consists of 
3318 ha (8200 acres) in several tracts in parts 
of Madison, Jackson, and Rockcastle counties 
of south-central Kentucky. BCF is maintained 
for watershed/wilderness resources, timber 
management, wildlife management, recrea- 
tion, and educational purposes by Berea Col- 
lege, Berea, Kentucky. In addition, the BCF 
has four reservoirs in Madison and Jackson 
counties diat pro\ide the water supplv for die 
citv of Berea and surrounding Madison Coun- 
tv communities and one reservoir for flood- 
prevention purposes. 

Prior to 1904, people from Berea obtained 
their water from wells or cisterns. In 1904, 
Berea College began collecting water from 
springs in die Berea College Forest and start- 
ed die Berea College Waterworks. In 1919, 
Upper Silver Creek Reservoir was built to col- 
lect and store water for the citv. A second res- 
ervoir. Lower Silver Creek Lake, was created 
in 1939 to pro\ide more water. Cowbell Lake 
was built in 1954 because of increased water 
demand bv Berea and soudi Madison Counts". 
As more water continued to be needed for Be- 
rea, its industrial areas, and south Madison 
County, Owslev Fork Reservoir was construct- 
ed in 1976. In 1986, Berea College was re- 



quired to build an earthen dam to serve as a 
flood-retarding structure for the overflow or 
breach of the Cowbell Reservoir dam. This ac- 
cumulated bodv of water is known as Red Lick 
Reservoir No. 2. These five reservoir lakes are 
managed and regulated bv Berea College Util- 
ities. 

Ferren and Tonsor (1996) defined a reser- 
voir as a pond or lake, natural or artificial, 
from which water may be withdrawn for irri- 
gation and/or water supplv. Our floristic studv 
is a baseline inventory with emphasis on die 
wetland and aquatic flora from collections and 
observations at five man-made bodies of water, 
or lakes, which we have termed "reservoirs" 
for descriptive purposes. These bodies of wa- 
ter are classified under the Lacustrine System 
of Cowardin et al. (1979), which are charac- 
teristically bounded bv uplands or bv wetlands 
dominated by shrubs, persistent emergents, 
and emergent mosses and lichens. 

Published botanical works for the Berea 
College Forest are Grossman and Pittillo 
(1962), Wade and Thompson (1990), and 
Thompson and Fleming (2004). Among diese 
three studies, over 600 plant species have 
been collected from die forest. Recent wet- 
land floristic studies in soudi-central and east- 
central Kentucky include Hoagland and Jones 



116 



Flora <>l Five Reservoirs in the Berea College Foresl — Thompson and Fleming, I I 




Kentucky 



Figure 1. The five reservoirs within the Berea College Forest. Bighill Quadrangle. Kentucky, Photon-vised 1979: 1 
Upper Silver Creek Reservoir, (2) Lower Silver Creek Reservoir, (3) Cowbell Reservoir, (4) Owsley Fork Reservoir, 
and (5) Red Lick Reservoir No. 2. Kentucky inset with Madison (upper left) and Jackson (lower right) counties dark- 
ened. 



(1992), Luken and Bezold (2000), and 
Thompson and FitzGerald (2003). 

Baseline inventories of the vascular flora 
from reservoirs are important for preserving 
wetland areas, moderating the effects of 
floods, improving water qualitv. and enhancing 
aesthetic and heritage value (Mitsch and Gos- 
selink 1993). Wetland studies have provided 
valuable information on soils, hvdrological pat- 
terns, plant communities, hvdrosere succes- 
sion, and environmental controlling factors 
(Meagher and Tonsor 1992). 

The objectives of our descriptive floristic 
survey were (1) to document the vascular flora 
vvitli representative voucher specimens, (2) to 
ascertain plant origin (i.e., native or exotic), (3) 
to indicate National Wetland Classification 
Status for each taxon, (4) to determine relative 
abundance, and (5) to describe habitats for 
each species. 

THE ENVIRONMENTAL COMPLEX 

Reservoir Descriptions 

Upper Silver Creek Reservoir (USC). Also 
known as Kale Lake or A-Lake, USC is the 
smallest reservoir, 2.1-ha surface area (5.3 



acres), and was formed by damming die East 
Fork of Silver Creek. The concrete dam lies 
at 341 m elevation. USC is 10 m deep at its 
deepest point with visibility of 3.5 m. Upper 
Silver Creek reservoir is located in Madison 
County at the end of a gravel road 2 km soudi 
of KY 21 and 5 km west of the US 421 junc- 
tion with KY 21 at Bighill (Figure 1). 

Lower Silver Creek Reservoir (LSC). LSC 
(B-Lake or North Lake) has 7.8-ha surface 
area (19.3 acres). The north-trending concrete 
dam spillway lies at 29S m elevation. LSC is 
10.5 m deep with visibility at 3 m. Lower Sil- 
ver Creek Reservoir lies 0.3 km north of USC 
on the East Fork Silver Creek and 1.7 km 
south of KY 21 (Figure 1). 

Coicbell Reservoir ( CRR ). CBR has 6.8-ha 
(16.8 acres) surface area and was formed by 
damming of the Cowbell Creek watershed. A 
north-trending earthen and concrete dam lies 
at 301 m elevation. CBR is 12 m deep with 
visibility of 3 m. Cowbell Reservoir is located 
in Madison County at the end of a gravel road 
1.8 km south of KY 21 and 2.4 km west ol 
junction US 421 and KY 21 at Bighill (Figure 
1). 



118 



Journal of the Kentucky Academy oi Science 65(2) 



Owsley Fork Reservoir (OFR). This, tin- 
largest reservoir, has 61.1-ha (151 acres) sur- 
face area. OFR was formed by damming Ows- 
ley Fork Creek and Radford Hollow tributary. 
The north- and northwest-trending earthen 
and concrete dam lies on the Madison and 
Jackson count)' boundary at 250 m elevation. 
OFR has a maximum depth of 12 m with vis- 
ibility of 3.5 m. Owsley Fork Reservoir is the 
only lake open to the general public, but with 
certain restrictions. OFR is located 4 km east 
of Bighill from the junction of US 421 with 
KY 21 which becomes Owsley Fork Road on 
the east side of OWF in Jackson County. A 
paved road, Radford Hollow Road, separates 
from Owsley Fork Road to the southwest of 
the dam on the Madison County side (Figure 
1). 

Red Lick Reservoir No. 2 (RLR). This res- 
ervoir of 3-ha (7.4 acres) was designed as a 
flood-retarding structure with an earthen dam 
formed from landfill from the adjacent mixed 
hardwood forest. The elevation of the dam top 
is 262 m. RLR is 5 m deep with limited visi- 
bility of 1 m. It is located 1.2 km north of 
Cowbell Reservoir on Cowbell Creek, and 0.7 
km south of KY 21 (Figure 1). 

Physiography and Geology 

The Berea College Forest of Madison and 
Jackson counties lies within the Knobs Lower 
Scioto Dissected Plateau Region of the West- 
ern Allegheny Plateau and the Knobs Normal 
Upland Region of the Interior Plateau (Wood 
et al. 2002). The geological substrate within 
the area of the Berea College reservoirs is very 
complex. Drainage below the reservoirs has 
some Holocene Alluvium (210-230 m) of the 
Quaternary System, and the valleys have some 
New Albany Shale (230-275 m) of the Upper 
Devonian and Lower Mississippian System. 
Bedrock surrounding the reservoirs on lower 
slopes consists of shale, siltstone, and lime- 
stone of die Nancy Member (275-335 m), 
Cowbell Member (335-365 m), Nada Mem- 
ber (365-385 m), and Renfro Member (385- 
396 m). All these members belong to the Bor- 
den Formation of the Mississippian System 
(Weir et al. 1971). The middle and upper 
slopes and ridgetops of the Knobs consist of 
limestone and shale of Newman Limestone 
Member (396^50 m) and Pennington For- 
mation (450-457 m) sandstone, siltstone and 



shak', both of the Upper Mississippian Sys- 
tem. Several higher Knobs are capped with 
the Livingston Conglomerate Member (457- 
470 m) and/or the Corbin Sandstone Member 
(470-488 m) in the Lee Formation of the 
Lower Pennsylvanian System (Weir et al. 
1971). 

Soils 

The majority of the forest soils surrounding 
the reservoirs belong to the the Weikert series 
or the Bledsoe-Gilpin-Shelocta-Grigsby series. 
The Weikert series are shallow, well-drained, 
moderately permeable soils with an acid pH 
from 4.5 to 5 derived mainly from acid silt- 
stones (Newton et al. 1973). The Weikert soil 
series includes the majority of the soils sur- 
rounding Cowbell, Red Lick Flood Retarding 
Structure, Upper Silver Creek, and Lower Sil- 
ver Creek reservoirs located entirely in Mad- 
ison County. The soils of the Bledsoe-Gilpin- 
Shelocta-Grigsby series are typically deep, 
well-drained, and moderately permeable soils 
with a pH from 4.6 to 7. They are formed 
mainly in mixed alluvium from acid siltstones 
and shales (Hayes 1989). This soil association 
is found only at the Owsley Fork Reservoir 
study site in Jackson and Madison counties. 

Climate 

The climate of Kentucky is warm temper- 
ate, humid mesothermal, with little or no wa- 
ter deficiency, and is characterized by long 
warm summers and short mild winters (Tre- 
wartha and Horn 1980). The mean annual 
temperature of Berea is 13.7°C. July and Au- 
gust are usually the warmest months, with a 
mean temperature of 24.6°C, and January is 
the coldest mondr, widi a mean temperature 
of 1.5°C. The mean annual precipitation is 
119.3 cm widi July having the highest precip- 
itation at 12.2 cm and October the lowest with 
5.8 cm. The mean frost-free growing season is 
189 days with the mean date of die last spring 
freeze on 15 April and the first fall freeze on 
22 October (Conner 1980). 

Vegetation 

Western Mesophytic Forest, a mosaic re- 
gion of Mixed Mesophytic Forest and Oak- 
Hickory Forest, is the predominant vegetation 
in The Knobs Border Area as described by 
Braun (1950). Muller and McComb (1986) 



Flora of Five Reservoirs in the Berea College Forest — Tl, 



wmpson nut 



I Fie 



classified the upland lorests Irom eight sites 
within the Kentucky Knobs Region into me- 
sophvtic hardwoods, white oak, chestnut oak, 
and scarlet oak forest types. The upland forest 
bordering the Berea College reservoirs on the 
north- and northwest-trending aspects is pri- 
marily a mosaic of mesophytic hardwoods 
(Liriodendron-Acer-Fagus-Quercus-Carya- 
Fraxinus). The forest stands on the east-trend- 
ing aspect and valley bottoms in the vicinity of 
the reservoirs are intermixed with mixed oak 
hardwoods-pine (Quercus-Pinus). All five res- 
ervoirs are surrounded by forests and open 
lands in various serai stages of secondary suc- 
cession. 

METHODS 

The vascular flora was collected from die 
wetland habitats of the five reservoirs through- 
out the growing seasons of 1995, 1996, 1998, 
and 2003. Plants not in wetland habitats (i.e., 
contiguous secondary successional ecotones, 
upland forests, and reservoir dams) were not 
included in the species list. Manuals used for 
plant identification were Gleason and Cron- 
quist (1991), Strausbaugh and Core (1978), 
and Beal and Thieret (1986). Plant classifica- 
tion and nomenclature are mostly from Glea- 
son and Cronquist (1991). Representative 
voucher specimens were processed according 
to standard herbarium procedures and depos- 
ited in the Berea College Herbarium (BE- 
REA). Previous plant collections from die 
BCF were also examined at BEREA. 

Six wetland habitats modified from Thomp- 
son and FitzGerald (2003) were delineated 
from field reconnaissance of wetland habitats 
and species composition in these wetland ar- 
eas from each reservoir. These wetland habi- 
tats are enclosed in brackets after the National 
Wetland Category in the Appendix. The six 
wetland habitats are (1) Vegetated Open Wa- 
ter (VOW) — an area of permanent water with 
a depth of up to 2 m with vegetation restricted 
to obligate free-floating species, floating- 
leaved submergents, and submergents; (2) 
Shrub Swamp (SS) — seasonally flooded area 
with saturated soils present when no standing 
water exists and dominated by riparian trees 
and shrubs with wetland herbaceous species; 
(3) Emergent Marsh (EM) — an area that is 
characterized by permanent or seasonal Hood- 
ing or by water letdown, resulting in saturated 



soils during dr\ summers, and thai supports 
obligate and facultative amphibious herba- 
ceous plants: (4) Sedge-grass Meadow 
(SGM) — an area that has typically saturated 
soils covered with shallow water during limes 
of increased rainfall and that supports obligate 
and facultative wetland herbs; (5) SeasonalK 
Dewatered Mud-Sand Flat (SDF) — an area 
that is inundated for most of the year but with 
water receding early enough in summer, sup- 
porting annual species along exposed mudflats 
or sandy shoreline. The boundary between the 
seasonally dewatered flats and emergent 
marshes may vary from year to year based 
upon precipitation, evaporation, and water 
drawdown; and (6) Shallow Stream with Grav- 
el Bar (SSG) — headwater inlet streams with 
vegetated streambanks, terraces, and gravel 
bar areas from periodical flooding; this habitat 
supports a rich assemblage of wetland and for- 
est perennial herbs and woody plants. The for- 
ests and open lands in various serai stages of 
secondary succession surrounding the reser- 
voirs were not inventoried for plants or in- 
cluded in the species list. 

The Appendix includes the species name, 
plant origin (native or exotic). National Wet- 
land Classification status, a representative wet- 
land habitat for each taxon, and the relative 
abundance value of each species found at each 
reservoir. 

An asterisk (*) preceding a species name 
denotes an exotic or non-indigenous plant spe- 
cies. After the species name is die National 
Wetland Category (Reed 1988). These Nation- 
al Wedand Categories are OBL = Obligate 
Wetland, FACW = Facultative Wetland, FAC 
= Facultative, FACU = Facultative Upland, 
and UPL = Upland, and may contain minus 
( — ) or plus ( + ) designations for the drier or 
wetter limits of the facultative categories. A 
Not Categorized (NC) has been created for 
those species not listed or classified in die 
1997 National Wetland Indicator Plant List, 
Northeastern Region 1 by the USFWS (1997) 
(Appendix). 

In the Appendix, abbreviations horizontally 
from the earliest to most recently established 
are reservoirs are: USC = Upper Silver Creek, 
LSC = Lower Silver Creek, CBR = Cowbell. 
OFR = Owsley Fork, and RLR = Red Lick 
Reservoir No. 2. Relative abundance values 
are listed under the columns lor each reser- 



120 



[oumal ot the Kentucky Academy <>i Science 65(2) 



Table 1. Classification of vascular plants at Five li 
voirs in tin- Berea College Forest. Kentucky. 















S|K-(_il-s 














composition 


Division 


Familii s 


Genera 


Species 


Native 


Exotic 


Equisetoph\ta 


1 


i 


2 


2 





0.69 


Lvcopodioplnta 


1 


i 


1 


1 





0.34 


Polypodiophyta 


3 


5 


7 


7 





2.40 


Pinophyta 


1 


1 


1 


1 





0.34 


Magnoliophyta 


59 


167 


281 


243 


38 


96.23 


Masjnoliopsida 


44 


125 


190 


167 


23 


65.07 


Liliopsida 


15 


42 


91 


76 


15 


31.16 


Totals 


65 


175 


292 


254 


38 


100.00 



voir. Relative abundance values adapted from 
Thompson and Jones (2001) are R = Rare — 
1 to 5 indhiduals or colonies; I = Infre- 
quent — 6 to 30 indhiduals or colonies; O = 
Occasional — 31 to 100 indhiduals or colonies; 
F = Frequent — hundreds of indhiduals or 
colonies; and A = Abundant — thousands of 
indhiduals or colonies (Appendix). 

RESULTS 

Taxonomic Summarv 

The documented vascular flora of die five 
Berea College Reservoirs comprises 292 spe- 
cies widiin 175 genera from 65 families. The 
annotated catalogue of plant species is com- 
posed of Lvcopodiophyta (1), Equisetoplrvta 
(2), Pohpodiophxta (7). Pinophvta (1), and 
Magnoliophvta (281). Thirty-eight species 
(13%) are exotics (Table 1). Two hundred five 
(70.0%) are OBL, FACW, and FAC wedand 
species (Appendix). The number of species in 
die wedand categories are OBL (61), FACW 
(73), FAC (70), FACU (61). UPL (11), and 
NC (16). Total species for each reservoir are 
USC (114), LSC (177), CBR (150), OFR 
(214), and RLR (135) (Appendix). The largest 
families in species are Asteraceae (48), Po- 
aceae (35), Cvperaceae (24), Lamiaceae (13), 
Fabaceae (12), Polvgonaceae (12), and Jun- 
caceae (9). The largest genera are Polygonum 
(11), Juncus (9), Panicum (9), Aster (8), and 
Carex (8) (Appendix). Polygonum densiflorum 
is documented as a new Kentucky record. 

Reservoir Flora and Habitats 

The five reservoirs have developed various 
wetland habitats dirough hvdrarch or hvdro- 
sere succession. Characteristic species and lo- 



eallv rare taxa are listed for each reservoir hab- 
itat. There is some zone intergradation in the 
species from the six habitats, some more con- 
spicuous then others; e.g., a gradient or con- 
tinuum exists between species among the EM. 
SS, and SDF habitats at Owslev Fork Reser- 
voir. 

The flora and habitats of the five reservoirs 
in the Berea College Forest — Upper Silver 
Creek, Lower Silver Creek, Cowbell, Owslev 
Fork, and Red Lick Reservoir Xo. 2 — are de- 
scribed from die oldest to die earliest created 
bodv of water. 

Upper Silver Creek Reservoir. The four 
habitats of USC are VOW EM. SDF, and 
SGM. Important submerged vegetation in the 
VOW are Xaja.s guadalupensis. X. minor and 
Potamogeton nodosus. The EM lies in steep 
areas surrounding die reservoir and at a small 
area by die dam spillwav. Generallv, the EM 
and SDF habitats are hea\ilv shaded bv the 
encroaching upland vegetation. Characteristic 
species of die EM include Alisma subcorda- 
tum, Cyperus strigosus, Juncus acuminatu.s, J. 
effusu.s var. solutus, Leersia oryzoide.s, Lud- 
wigia alternifolia, Scirpus cyperinus, and Scu- 
tellaria lateriflora. 

The SDF occurs as small slough delta areas 
at die northwest shore and east shore, which 
are created from side ra\ine stream siltation 
and water drawdown. T\pical taxa of this hab- 
itat include Bidens spp., Boehmeria cylindrica, 
Impatiens capensis, Ludwigia alternifolia, Ly- 
copus virginicus, Mimulus alatus, and Pentho- 
rum sedoides. At die north end on die lower 
part of die dam, a small wet-meadow seepage 
exists. Some SGM species include Apocynum 
cannabinum, Carex frankii, C. lurida, C. vul- 
pinoidea, Eupatorium perfoliatum, E. serotin- 
um, Linum striatum, Polygala sanguinea, Scir- 
pus atrovirem, and S. pendulus. Scirpus po- 
lyphyllus is restricted to USC. 

The USC flora is represented bv 27 OBL. 
27 FACW, 26 FAC. 25 FACU, 4 UPL, and 5 
NC species. 

Lower Silver Creek Reservoir. The five 
wedand habitats of LSC are VOW, EM, SDF 
SS, and SGM. The VOW habitat contains Xa- 
jas guadalupensis, X. minor, and Potamogeton 
nodosus. The EM zone occurs at die north- 
western end by die concrete spillway, exten- 
sively at die southern end, and in small areas 
along the w T est-and-east trending banks. Char- 



Flora "I Five Reservoirs in the Berea College Forest— Thon 



vpson mid Fleming 



121 



acteristic emergents arc Eleocharis quadran- 
gulata, Juncus acuminatus, Juncus effusus var. 
solutus, Leersia oryzoides, Scirpus cyperinus, 

S. validus, and Typha latifolia. Other EM taxa 
include Acorus calamus, Asclepias incarnata, 
Carex spp., Hypericum mutilum, Ludwigiaal- 
ternifolia, L. palustris, Lycopus oirginicus, 
Onoelea sensibilis, and Panicum rieidulum. 

The SDF habitat nearly encompasses the 
entire reservoir during times of water draw- 
down except at the concrete dam. Character- 
istic species are Bidens spp., Boehmeria ci/lin- 
drica, Fimbristylis autumnalis, Impatiens ca- 
pensis, Lycopus oirginicus, Microstegium oi- 
mineum, Mimulus alatus, M. ringens, 
Polygonum spp., Scirpus atrovirens, and Xan- 
ihium strumarium. A small zone of SS behind 
the EM at the south end includes scattered 
Platanus occidentalis, Salix cxigua, S. nigra, S. 
sericea, and Sambucus canadensis. The her- 
baceous laver of SS mainly comprises species 
present in the seasonally dewatered flats and 
emergent marsh. The SGM habitats in die 
southern terminus and die northern end com- 
prise the most floristicallv rich habitat. Char- 
acteristic SGM species include Agrimonia 
parviflora, Asclepias incarnata. Aster dumo- 
sus, Carex frankii, C. lurida, C. tribuloides, C. 
oulpinoidea, Eupatorium coelestinum, E. jis- 
tulosum, E. perfoliatum, Euthamia gramini- 
folia, Helianthus angustifolius, Lobelia cardi- 
nalis, L. siphilitica, Panicum clandestinum, 
Poli/gala sanguinea, Rhcxia oirginica, and Spi- 
ranthes cernua. 

Wetland species found only at LSC are Aco- 
rns calamus. Aster puniceus. Carex squarrosa, 
C. stipata, Cyperus brevifolioides, Habenaria 
flava, H. lacera, H. pcramocna, Lilium cana- 
dense, Pluchea camphorata, and Solidago ru- 
gosa (Appendix). 

The LSC flora is represented by 36 OBL, 
50 FACW, 40 FAC, 36 FACU, 5 UPL, and 10 
NC species. 

Cowbell Reservoir. Four wetland habitats 
at CBR are classified as VOW, EM. SDF. and 
SS. The perimeter is entirely forested with 
steep terrain on both the east and west-trend- 
ing banks. Najas guadalupensis, Potamogeton 
diversifolius. P. nodosus, and P. pusillus, are 
found in the VOW zone. The EM at the south 
and southwest watershed area supports typical 
hvdrosere successional plants. Characteristic 
emergent species are Eleocharis quadrangu- 



lata, JunCUS effusus var. SolutUS, Leersia ory- 

zoides, Panicum rigidulum Scirpus cypt rinus 
S. pendulus, and Typha latifolia. The SDF 
zone is located around shoreline especiall) on 

the west and south sides. Characteristic spe- 
cies along the SDK shoreline are Boehmeria 
cylindrica, Carex vulpinoidea, Impatiens ca- 
pensis, I. pallida. Junius tenuis, Lycopus oir- 
ginicus, Polygonum cespitosum var. hngise- 
lum. Polygonum punctatum, and Rotala ra- 
mosior. 

Shrub swamp habitats are located on the 
east and west banks at CBR. Indicator wood) 
trees are Acer negundo, A. saccharinum, Bet- 
ula )iigra. Platanus occidentalis, Populus del- 
toides, and Salix nigra. Characteristic shrubs 
are Hydrangea arborescens, Lindera 1/cuzoin. 
and Sambucus canadensis. Toxicodendron racl- 
icans is the most prevalent woody vine. Her- 
baceous plants in the SS differ little in species 
composition from those found in the sur- 
rounding EM and SDF habitats. 

Wetland species, Betula nigra. Gratiola neg- 
lecta, Populus deltoides, Potamogeton diicrsi- 
folius. P. pusillus, and Thelypteris hexagonop- 
tera, are recorded only from CBR (Appendix). 

The CBR flora consists of 34 OBL. 35 
FACW, 34 FAC, 35 FACU. 4 UPL. and 8 NC 
species. 

Owsley Fork Reservoir. All six wetland 
habitats— VOW, EM, SDF. SS, SGM, and 
SSG — are present at OFR. Characteristic spe- 
cies in the VOW are Najas guadalupensis, N. 
minor, Potamogeton illinoensis, and P. nodo- 
sus. Two large areas of EM are present at 
OWF; one located at die western shore of 
Madison County and the other at the south- 
eastern shore of Jackson County. Characteris- 
tic emergents are Alisma subcordatum. Eleo- 
charis palustris, E. quadrangulata, Equisetum 
arvense, E. hyemale, Galium tinctorium, jun- 
cus effusus var. solutus. Ludwigia alternifolia, 
Sagittaria australis. Scirpus purshianus, S. 
validus. Typha angustifolia, and T. latifolia 
(Appendix). 

The Seasonally Dewatered Mud-Sand Flats 
encircle the entire lake in the southwest and 
southeast coves of the reservoir where the 
shoreline is much more level, exposed, and 
drier during water letdown than the shaded 
north-trending aspect. Characteristic species 
of the SDF are Bidens spp.. Cyperus strigo- 
sus. Diodia oirginiana, Eclipta prostrata, Eleo- 



122 



Journal of the Kentucky Academy "I Science (i5 2 



charts ovata, Lindernia dubia, Ludwigia pal- 
ustris, Lysimachia nummularia, Penthorum 
sedoides, Polygonum spp., Rotala ramosior, 
Scirpus purshianus, Scutellaria lateriflora, and 
Xanthium strumarium. 

Shrub swamp habitats serve as an intergrad- 
ing boundary between the SDF and EM zones 
in the largest coves of Owsley Fork Reservoir. 
Woodv species of the Jackson counts' SS in the 
eastern comer of the lake are Acer negundo, 
A. saccharinum, Cornus drummondii, Platan- 
us occidentalis, Salix exigua, S. nigra, and S. 
sericea. Herbaceous wetland species princi- 
pally include those of die SGM and SDF 
zones. The SS in the northwest corner of the 
reservoir in Jackson Counts' has nearly the 
same floristic composition in die Madison 
County side. 

Owsley Fork Reservoir has a large SGM on 
the north side in Jackson Counts' and also on 
die east side in Madison Count)'. The SGM 
species include Agalinis purpurea, Agrimonia 
partiflora, Apocynum cannabinum. Asclepias 
incarnata, Eupatorium coelestinum, E. fistu- 
losum, E. peifoliatum, lmpatiens capensis, 
Juncus spp., Mentha ^piperita, and Scirpus 
atrovirens. The SSG zones were present at the 
watershed of the SS of bodi Madison and 
Jackson counties where intermittent streams 
are located. Characteristic woody taxa include 
Campsis radicans, Clematis virginiana, Hy- 
drangea arborescens, Lindera benzoin, Sam- 
bucus canadensis, and Toxicodendron radi- 
cans. On the streambanks and gravel bars are 
found Bidens spp.. Boehmeria cylindrica, Eq- 
uisetum arvense, lmpatiens capensis. I. palli- 
da, Lobelia siphilitica, and Microstegium vi- 
mineum. 

Wetiand species restricted to OFR are Ci- 
cuta maculata, Cornus drummondii, Eleochar- 
is tenuis. Epilobium coloratura, Equisetum 
hyemale, Galium tinctorium, Juncus brachy- 
carpus, J. diffusissimus, J. torreyi, Leucospora 
multifida, Lycopus americanus, Lysimachia 
nummularia. Potamogeton illinoensis, Sagit- 
taria calycina, and Typha angustifolia. 

The OFR flora is made up of 47 OBL, 55 
FACW, 51 FAC, 42 FACU, 10 UPL, and 9 NC 
species (Appendix). 

Red Lick Reservoir No. 2. RLR has all six 
wedand habitats— VOW, EM, SDF, SS, SGM, 
and SSG. Characteristic plants of die VOW 
habitat are Brasenia schreberi, Lemna minor, 



Najas guadalupensis, and Potomogeton nodo- 
sus. The EM at this reservoir lies along the 
east-facing bank and the southern end of the 
lake. Smaller areas of this habitat can also be 
found in the northwest corner near the dam 
and along the steep, west-trending bank of un- 
disturbed mesophstic hardwood forest. The 
EM zone is dominated bv Eleocharis quad- 
rangulata. Juncus effusus sar. solutus, Leersia 
oryzoides, Panicum rigidulum, Polygonum 
densiflorum, Scirpus cyperinus, Sparganium 
americanum, and Typha latifolia. 

The SDF habitats are located in the south 
end between die SS and die EM and in a few- 
other small sites depending on die seasonalls 
evaporated water levels. Characteristic species 
include Cyperus strigosus, Eleocharis ovata, 
Fimbristylis autumnalis, lmpatiens capensis, 
Lindernia dubia var. anagallidea. Ludwigia al- 
ternifolia, Penthorum sedoides, Rotala ramo- 
sior, and Xanthium strumarium. 

A small SS zone at the south end near the 
SSG entrance and on die disturbed west shore 
has Alnus glutinosa, Cornus amomum, Liquid- 
ambar styraciflua, Platanus occidentalis, and 
Salix nigra. Herbaceous plants are primarily 
diose of die SDF and SGM. The SGM along 
the west side includes Boehmeria cylindrica, 
Carex lurida, C. tribuloides. Equisetum ar- 
vense, Helianthus angustifolius, Lobelia siphil- 
itica, Lythrum salicaria, Mimulus alatus, Pilea 
pumila, and several odier species found main- 
ly on die SDF. The SSG habitat, located at 
the soudiem terminus of die reservoir, is flo- 
ristically different from any of die odier hab- 
itats. The SSG streambanks include Carpinus 
caroliniana, Hydrangea arborescens, Liquid- 
ambar styraciflua, and Sambucus canadensis; 
gravel bars support Boehmeria cylindrica, 
Carex torta, Equisetum arvense, Glyceria stri- 
ata, and lmpatiens capensis. 

Alnus glutinosa, Brasenia schreberi, Carex 
torta, Cornus amomum, Lemna minor, Lud- 
wigia decurrens, Liquidambar styraciflua. 
Lythrum salicaria, Panicum verrucosum, Po- 
lygonum densiflorum, and Sparganium amer- 
icanum are ssetland species found only at 
RLR. 

The RLR flora is composed of 35 OBL, 34 
FACW, 32 FAC, 26 FACU, 3 UPL, and 5 NC 
species (Appendix). 



Flora ol Five Reservoirs in the Berea College Foresl Thompson and Fleming 123 



DISCUSSION 

The five Berea College reservoirs exhibit 
similar stages ol hvclrosere succession com- 
posed of characteristic wetland species in spe- 
cific wetland habitats. Each reservoir varies in 
development of plant habitats and species 
composition based in part on factors of res- 
ervoir age, size and depth, existing vegetation 
contiguous to the lakes, hydrarch succession, 
and copper sulfate algicide treatments. The 
four reservoirs used for utilities water are cur- 
rentlv mesoligotrophie. Although Red Lick 
Reservoir No. 2 is the most recently formed 
reservoir, it has advanced to a more eutrophic 
stage than the older reservoirs. Some contrib- 
uting factors include sedimentation from ad- 
jacent reclaimed land, shallow depth, and a 
lack of direct copper sulfate treatments. 

The species richness of wetland and aquatic 
vascular plants appears to be high with 70% 
belonging to the OBL, FACW, and FAC cat- 
egories. This is a significant percentage con- 
sidering that the upland forested and open 
terrain is predominately composed of FACU 
and UPL species. Each resen'oir has transi- 
tional zones of upland forest and grassy areas 
bordering die wetland habitats. Many facul- 
tative species have taken advantage of die 
moisture regimens of these reservoirs. Red 
Lick Reservoir No. 2 has a species richness 
comparable to die other four reservoirs in to- 
tal plant species including its number of wet- 
land and aquatic plants. 

Hydrarch succession, a type of progressive 
secondary succession, has been induced by a 
number of factors at the reservoirs. The first 
of these factors may have been die presence 
of viable seed banks prior to reservoir con- 
struction. Once these diaspores were given the 
appropriate environmental conditions for ger- 
mination and subsequent growth, thev became 
established as various habitats developed. Wa- 
ter and wind are important dispersal mecha- 
nisms for propagules. The flora and fauna have 
shaped the floristic composition in a number 
of ways. Animals have aided in the distibution 
of viable seeds to account for a greater species 
richness. Waterfowl, for example, could be re- 
sponsible for certain wetland species that 
clearly were not present prior to lake forma- 
tion, e.g.. Aconis calamus, Brasenia schreberi, 
Lcmua minor. Sagittaria calycina, and Spar- 



gfmium americanum. The flora allows for the 
formation ol better-suited habitats for wetland 
species, through decaying of plant material, 
resulting in the addition ol organic material to 
the soil, and through increased evapotranspi- 
ration. allowing for areas with drier soils 
(Mitsch and Gosselink L993). These factors 
have increased the ability of these areas to 
support various degrees of high species rich- 
ness. 

Several wetland and aquatic species are lo- 
cally rare in the wetland habitats of the five 
reservoirs. These tax a often are restricted to a 
single reservoir site, i.e.. Habenaria lima. II. 
lacera, and H. peramoena at Lower Silver 
Creek Reservoir. We encountered no threat- 
ened, endangered, or special concern taxa for 
Kentucky (KSNPC 2000). We did document 
the presence of Polygonum densiflorum, a new 
Kentucky distribution record. Overall, 292 
species have become established in the res- 
ervoirs within 10 to 77 years. 

ACKNOWLEDGMENTS 

Gratitude is extended to the Appalachian 
College Association, Inc., Berea, Kentucky, for 
financial support during summer 1998 
through a Mellon Faculty/Student Research 
Grant awarded to Berea College. Special 
thanks are given to Rudv A. Gelis, a Berea 
College biology graduate, for field assistance 
and field collections from the Berea College 
Reservoirs. 

LITERATURE CITED 

Beat, E. O., and J. W. Thieret. 19S6. Aquatic and wetland 
plants of Kentucky. Kentucky Nature Preserves Coram. 
Sci. Techn. Ser. 5. 

Braun, E. L. 1950. Deciduous forests of eastern North 
America. Hafner Publishing Company, New York. NY. 

Conner. G. 19S0. Climate of Berea. Kentucky. Climatol- 
ogy of Kentucky series. Kentucky Climate Center, 
Western Kentucky Univ.. Bowling Green. KY. 

Cowardin, L. M., V. Carter, F. C. Golet, and E. T. LaRoe 
1979. Classification of wetlands and deepwater habitats 
of the United States. Office of Biological Sciences. Fish 
and Wildlife Service, U.S.D.I. FWS OBS-79/31. 

Ferren. F. C... and S. J. Tonsor. 1996. Wetland classifica- 
tion methodology. Madrono 43:157— 178. 

Cleason, H. A., and A. Cronquist. 1991. Manual of vas- 
cular plants of northeastern United States and adjacent 
Canada, 2nd rd. New York Botanical Garden, Bronx, 
NY. 

Grossman, J., and t). Pittillo. 19(i2. Shrubb) and herba 



124 



uillliul I) 



I ihc Kentucky Academy of Science 65(2) 



ceous flora of Berea College Forest. Trans. Kentuck) 
Acad. Sci. 23:61-73. 

Hayes, R. A. 19S9. Soil survey of Jackson and Owsle) 
Counties, Kentucky. U.S.D.A. Soil Conservation Service 
and Forest Service. Washington, DC. 

Hoagland, B. W., and R. L. Jones. 1992. Wetland and 
riparian flora of the Upper Green River Basin, south- 
central Kentucky. Trans. Kentucky Acad. Sci. 53:141- 
153. 

[KSXPC]. Kentucky State Nature Preserves Commission. 
2000. Rare and extirpated biota of Kentuck)'. J. Ken- 
tucky Acad. Sci. 61:115-132. 

Luken, J. O., and T. N. Bezold. 2000. Species richness 
and wetland status of different shoreline elements at 
Cave Run Lake, Kentuck). Castanea 65:126-138. 

Meagher, W. L., and S. J. Tonsor. 1992. The checklist of 
the vascular flora of the Augusta Floodplain Preserve. 
Michigan Bot. 31:83-98. 

Mitsch, W. J., and J. G. Gosselink. 1993. Wedands, 2nd 
ed. Van Nostrand Reinhold, New York, NY. 

Muller, R. N., and W C. McComb. 1986. Upland forests 
of the Knobs Region of Kentucky. Bull. Torrey Bot. 
Club 113:260-280. 

Newton, J. H.. H. P. McDonald, D. G. Preston, A. J. Rich- 
ardson, and R. P. Sims. 1973. Soil survey of Madison 
County', Kentucky': U.S.D.A. Soil Conservation Sendee, 
Washington, DC. 

Reed, P. B., Jr. 1988. National list of plant species that 
occur in wedands: 1988 national summary. Biological 
Report 88(24). U.S.D.I., U.S. Fish and Wildlife Service, 
Washington, DC. 

Strausbaugh, P. D., and E. L. Core. 1978. Flora of West 
Virginia, 2nd ed. Seneca Books, Grantsville, WV. 

Thompson, R. L.. and E. W. J. FitzGerald, Jr. 2003. Vas- 



cular flora of Feltner Lake, Laurel County, Kentucky. 
J Kentuck) Kcad Sci, 64 75-92. 

Thompson, R. L., and C. A. Fleming. 2004. Vascular flora 
and plant communities ol the John B. Stephenson Me- 
morial Forest State Nature Preserve (Anglin Kails Ra- 
vine), Rockcastle County, Kentuck). Castanea 69:125- 
138. 

Thompson, R. L.. and R. L. Jones. 2001. Woody plants of 
Rock Creek Research Natural Area and watershed up- 
lands. Laurel County, Kentucky Castanea 66:275—287. 

Trewartha, G. T, and L. H. Horn. 1980. An introduction 
to climate. 5th ed. McGraw-Hill Book Co., New York. 
NY. 

[USFWS]. United States Fish and Wildlife Seniee. L997. 
National list of vascular plant species that occur in wet- 
lands: 1996 national summary. National Wetlands In- 
ventory, U.S. Fish and Wildlife Service, Washington, 
DC. 

Wade, G. L., and R. L. Thompson. 1990. Establishment 
of native plant species from forest topsoil seedbanks on 
a borrow area in Kentucky Pages 451^160 in Proceed- 
ings of the 1990 Mining and Reclamation Conference 
and Exhibition. Vol. II. West Virginia University, Mor- 
gantown, WV 

Weir, G. W, K. Y. Lee, and P. E. Cassidv. 1971. Geologic 
map of die Bighill Quadrangle, east-central Kentucky 
GQ-900. U.S. Geological Survey (map scale 1:24,000), 
Washington, DC. 

Wood, A. J., J. M. Omemik. W. H. Martin, G. J. Pond, 
W. M. Andrews, S. M. Call, J. A. Comstock, and D. D. 
Taylor. 2002. Ecoregions of Kentucky (color poster with 
map, descriptive text, summary tables, and photo- 
graphs). U.S. Geological Survey (map scale 1: 
1,000,000), Reston, VA. 



Flora of Five Reservoirs in the Berea College Forest — Thompson and Fleming 125 
Appendix. Vascular plants of the live- Berea College Reservoirs, Madison and Jackson counties K. ntucky. 



Relative ubundj 



Taxon Nations] Wetland Category [wetland habitat] 



hi CBR lilH 



Equisetophyta 
Equisetaceae 

Equisetum arvense L. FAC. [SSG] 

E hyemale L. FACW. [SS] 
Lycopodiophyta 
Selaginellaceae 

Selaginella apoda (L.) Fern. FACW. [SSG] 
Polypodiophyta 
Aspleniaceae 

Athyriumfilix-femina (L.) Roth. FAC. [SSG] 

A. pyenocarpon (Spreng.) Tidest. FAC. [SSG] 

A. thelypterioides Michx.) Desv. FAC. [SSG] 

Polystichum acrostichoides (Michx.) Scliott. FACU-. [SSG] 

Thelypteris hexagonoptera (Michx.) Weatherbv. FAC. [SSG] 
Onocleaceae 

Onoclca sensibilis L. FACW. [SCM] 
Ophioglossaceae 

Bolrychium dissectum Spreng. FAC. [SDF] 
Pinophyta 
Taxodiaceae 

Taxodium distichum (L.) Rich. OBL. [SDF] 
Magnoliophyta 
Aceraceae 

Acer negttndo L. FAC + . [SDF] 

A. nibnim L. FAC. [SSG] 

A. saccharinum L. FACW [SS] 
Acoraceae 

Acorus calamus L. OBL. [EM] 
Ahsmataceae 

Alisma subcordatum Raf. OBL. [EM] 

Sagittaria australis (J.G. Smith) Small. OBL. [EM] 

S. calycina Engelm. OBL. [EM] 
Anacardiaceae 

RJms copallina L. FACU-. [SSG] 

fi. glabra L. NC. [SGM] 

Toxicodendron radicans (L.) Kuntze. FAC. [SDF] 
Apiaceae 

Cicuta maculate L. OBL. [SGM] 

Cryptotaenia canadensis (L.) DC. FAC. [SGM] 
*Daucus carota L. NC. [SGM] 

Osmorhiza claytonii (Michx.) Clarke. FACU-. [SGM] 

Sanicula canadensis L. UPL. [SGM] 
Apocynaceae 

Apocynum cannabinum L. FACU. [SGM] 
Asclepiadaceae 

Ampelamus albidus (Nutt.) Britt. FAC. [SDF] 

Asclepias incarnaia L. OBL. [SDF] 
\ syriaca L. FACU-. [SGM] 

A. tuberosa L. NC. [SGM] 

A. nitidis Walt. NC. [SGM] 
Asteraceae 
*AchUlea millefolium L. FACU. [SGM] 

Ambrosia artemisiifolia L. FACU. [SGM] 

A. trifida L. FAC. [SGM] 

Aster cordifolius L. NC. [SSG] 

A. dumosus L. FAC. [SGM] 

A. divaricatvs L. NC. [SSG] 

A lateriflorus (L.) Britt. FACW-. [SDF] 

A. ontarionis Wieg. FAG. [SD1 



O O I 



n 
R 






I 
1 


1 


O 

1 







1 




R 


R 



I 



I 

o 
I 



() 



R 



R 



I 


I 


o 


F 


I 


R 


o 


I 


R 


o 




I 
I 

F 





O 


1 
o 


O 


F 


O 


I 


— 


I 


R 

I 


— 


I 


o 


I 


O 


1 


R 


— 


I 


R 


— 


R 


o 


I 


1 


— 


O 


o 


o 


F 


I 


I 


o 


1 


1 
F 


1 


I 


1 


1 


1 


R 


— 


R 


— 


R 


— 


R 

1 


R 
O 


I 









O 


I 





o 


— 


O 


— 





o 





() 


I 


1 
1 
[ 




! 


1 


I 


1 




1 



126 



[ourna] oJ the Kentuck) Academy oi Science 65(2 



Appendix, ( lontinued. 



Taxon, National Wetland Categoiy. [wetland liabital 



.A. pOosus Willd. UPL. [SGM] 

A. prenanthoides Muhl. FAC. [SDF] 

A. puniceus L. OBL. [SDF] 
Btdens rcnnm L. OBL. [SDF] 

B. frondosa L. FACVV. [SGM] 
B.polylepis S. F. Blake. FACW. [SGM] 

^Chrysanthemum leucanthemum L. UPL. [SGM] 
Comjza canadensis (L.) Cronq. UPL. [SGM] 
*Eclipta prostrata (L.) L. FAC. [SDF] 
Elephantopus carolinianus Willd. FACU. [SGM] 
Erechtites hieracifolia (L.) Raf. FACU. [SGM] 
Eupatorium coelestinum L. FAC. [SGM] 
E. fistulosum Barratt. FACW. [SDF] 
E. purpureum L. FAC. [SGM] 
E. perfoliatum L. FACW+. [SGM] 
E. rotundifolium L. FAC-. [SGM] 
E. serotinum Michx. FAC-. [SGM] 
Euthamia graminifolia (L.) Nutt. FAC. [SGM] 
Helenium flexuosum Raf. FAC—. [SDF] 
Helianthus angustifolius L. FACW. [SDF] 
Helianthus microcephalus T. & G. NC. [SGM] 
7r<7 annua L. FAC. [SGM] 
Lactuca canadensis L. FACU — . [SGM] 
P/uc/iea camphorata (L.) DC. FACW. [SDF] 
Polynmia uvedalia L. FAC. [SGM] 
Prenanthes altissima L. FACU-. [SGM] 
Pyrrhopappus carolinianus (Walt.) DC. NC. [SGM] 
Rudbeckia fulgida Ait. FAC. [SDF] 
R hirta L. FACU. [SGM] 
R triloba L. FACU. [SGM] 
Silphium trifoliatum L. FAC. [SGM] 
Solidago caesia L. FACU. [SDF] 
S. canadensis L. FACU. [SGM] 
S. flexicaulis L. FACU. [SDF] 
S. glgantea Ait. FACW. [SDF] 
S. rugosa P. Mill. FAC. [SGM] 
*Sonchus asper (L.) Hill. FAC. [SGM] 
Verbesina alternifolia (L.) Britt. FAC. [SGM] 
Vernonia gigantea (Walt.) Trel. FAC. [SGM] 
Xanthium struniarium L. FAC. [SDF] 

Balsaminaceae 

Impatiens capensis Meerb. FACW. [SGM] 
I pallida Nutt. FACW. [SSG] 

Betulaceae 
*Alnus glutinosa (L.) Gaertn. FACW-. [SS] 
Betula nigra L. FACW. [SS] 
Carpinus caroliniana Walt. FAC. [SS] 
Corylus americana Walt. FACU—. [SWG] 

Bignoniaceae 

Campsis radicans (L.) Seem. FAC. [SSG] 

Brassieaceae 
*Cardamine hirsuta L. FACU. [SGM] 
Lepidium virginicum L. FACU—. [SGM] 
Rorippa palustris (L.) Bess. OBL. [EM] 

Cabombaceae 

Brasenia schreberi J. F. Gmel. OBL. [VOW] 

Campanulaceae 

Campanula americana L. FACU. [SGM] 
Lobelia cardinalis L. FACW+. [SGM] 
L. inflata L. FACU. [SDF] 






R 





— 





— 





I 


I 


— 


1 


1 


o 


o 





1 





I 


o 

I 




1 


R 


— 


[ 
o 


I 


— 


— 


— 


R 


R 


R 


— 


o 


1 


O 


I 


I 


F 
R 
O 

1 
O 


— 


O 


O 


I 


I 


F 


O 


I 


o 


O 


O 


— 


o 


o 


O 
I 


— 


— 


o 


R 


O 


I 


o 


O 
R 
R 
I 
R 
R 


I 


I 

R 


— 


— 


I 


— 


— 


I 


R 


— 


— 


R 


I 


R 


— 


— 


I 


— 


I 


— 


O 


I 


I 


O 


I 


— 


F 


— 


O 


I 


O 


o 


O 


I 


— 


— 


— 


R 


O 


— 


— 


o 


— 


— 


R 





o 





O 


— 


I 


— 


I 


— 


I 


o 


O 


F 


I 



F 


A 


F 


I 


I 


I 







I 


R 


— 






I 


I 




I 


I 


I 
R 


O 

I 


I 


I 


o 


— 




— 


F 




I 







I 


— 


I 


o 


I 



Flora of Five Reservoirs in the Berea College Forest — Thompson and Fleming 127 

Vppendix. < Continued. 



Taxon. National Wetland Categoi) [wetland I 











1 M 


use 


CBR 


OFR 


Rl.K 





1 





1 





1 
I 




C) 
R 


1 


O 


I 


n 


F 


F 


() 


1 





1 
R 


() 


1 


1 





O 


O 





1 


1 


I 


1 
1 


1 
I 


I 


o 

1 


I 

I 


1 

o 

R 

1 
O 


I 

R 


— 


I 
o 


I 


1 
R 


I 


I 
I 

F 
I 
R 

I 


I 


o 


1 


R 


I 


F 


O 


R 


— 


O 


o 

I 


1 


F 

I 


o 


O 


o 


I 


I 
O 


o 


R 
O 


o 


I 


F 


F 
I 

F 


F 
F 
O 

O 

o 


o 


— 


F 


F 


— 


O 


— 


O 


I 


1 


I 


F 


R 


O 


F 


F 


F 


O 


I 
R 


— 


I 


O 


R 


— 


F 


1 


F 
F 


F 
1 


1 


O 


— 


O 

O 
R 
O 


I 


— 


R 


R 




— 


1 


I 


O 


1 


— 


— 


R 


R 


— 


O 


F 


O 


F 


O 


— 


— 


— 


1 


O 



L puberula Michx. FACW-. [SDF] 

L, syphilitica I.. FACW+. [SGM 

L. spicata Lam. FAC — . [SGM] 

Triodanis perfoliata L Nieuwl. FAC. siai 
Caprifoliaceae 
*Lonicera japonica Thunb. FAC—. [SGM 

Sambucus canadensis L. FACW. [SWG 

Viburnum rufidulum Raf. UPL. [SDF] 
Clusiaceae 

Hypericum mulilum L. FACW. [SDF] 

H punctatum Lam. FAC-. [SDF] 
Commelinaceae 

*Commelina communis L. FAC—. [SGM! 
Convolvulaceae 

Calystegia sepium L. R. Br. FAC-. [SGM] 
*lpomoea laatnosa L. FACW. [SDF] 

7. pandurata (L.) G.Mey. FACC. [SGM] 
Cornaceae 

Cornus amomum P. Mill. FACW. [SS] 

C. drummondii C. A. Mey. FAC. [SS] 
Cuscutaceae 

Cuscuta gronovii Wild. NC. [EM] 

C. indecora Choisv. NC. [SDF] 

C. pentugona Engelm. NC. [SGM] 
C\peraceae 
' Carexfrankii Kunth. OBL. [EM] 

C. hirsutella Mack. FACC. [SDF] 

C. lurida Wahl. OBL. [EM] 

C. squarrosa L. FACW. [EM] 

C. stipata Wild. OBL. [EM] 

C. torta F. Booth. FACW. [SSG] 

C. tribuloides Wahl. FACW+. [EM 

C. mdpinoidea Michx. OBL. [EM] 

Cyperus breiifolioides Thieret 6c Delahoussave FACW. [SGM] 

C. flavescens L. OBL. [SDF] 

C. strigostis L. FACW. [EM] 

Eleocharis ovata (Roth) R. & S. OBL. [SDF] 

£. palustris (L.) R. & S. OBL. [EM] 

E quadrangulata Michx.' R. & S. OBL. [EM] 

E. tenuis (Willd.) Schult. FACW+. [SDF] 

Fimbristylis autumnalis L. R 6c S. FACW+. [SDF] 

Rlujnchospora capitellata (Michx.) Valil. OBL. [EM] 

Scirpus atrovirens Muhl. OBL. [SDF] 

S. cyperinus (L.) Kunth. FACW+. [SDF] 

S. pendulus Muhl. OBL. [EM] 

S. pohjphtjllus Vahl. OBL. [EM] 

S. purshianus Fern. OBL. [EM] 

S. calidus Vahl. OBL. [EM] 

Scleria triglomerata Michx. FAC. [SGM] 
Dioscoreaceae 

*Dioscorea batatas Dene. NC. [SSG] 
Euphorbiaceae 

Acahjpha rhomboidea Raf. FACU— . [SDF] 

X i-'irginica L. FACC-. [SDF] 

Euphorbia maculata L. FACC — . [SDF' 

£. nutans Lagasca. FACU—. [SDF] 

PhyUanthus carvlinicnsis -Walt. FAC- SDK 
Fabaeeae 

Amphicarpaea bracteata I.. Fern. FAC. [S(.\l 

Apios americana Metlik. FACW. .EMi 



L28 



journal nl the Kentuck) Acadi 



f Science 65(2) 



Appendix. ( Continued. 



Relative abundances 



Toxon. \.[i i! Wetland * ategory. [wetland habitat] 



Chamaecrista fasciculata (Michx.) Greene. FACU. [SGM] 

Desmanthus ittinoensis (Michx.) MacMill. FAG [SGM] 

Desmodium paniculatum (L.) DC. UPL. [SGM] 
*Lespedeza cuneata (Duni Cours.) Don. FACU — . [SDF] 

L. intermedia (S. Wats.) Britt. NC. [SGM] 
*L. stipulacea Maxim. FACU. [SDF] 
*L. striata (Thunb.) H. & A. FACU. [SDF] 
*Melihtus alba Desr. FACU-. [SGM] 

Strophostyles umbellata (Muhl.) Britt. FACU-. [SGM] 
*Trifolium pratense L. FACU-. [SGM] 
Gentianaceae 

Sabatia annularis (L.) Pursh. FAC + . [SDF] 
Hamamelidaceae 

Liquidambar styraciflua L. FAC. [SS] 
Hydrangeaceae 

Hydrangea arborescens L. FACU. [SSGF] 
Juncaceae 

Juncus acuminatum Michx. OBL. [EM] 

/. biflorus Ell. FACW. [SGM] 

/. brachycarpus Engelm. FACW. [SGM] 

/. diffusissimus Buckl. FACW. [SGM] 

/. dudleiji Wieg. FAC-. [SGM] 

J. effusus L. var. solutus Fern. & Wieg. OBL. [EM] 

/. marginatus Rostk. FACW. [SDF] 

/. tenuis Willd. FAC-. [SGM] 

/. torreyi Cov. FACW. [SGM] 
Lamiaceae 

Collinsonia canadensis L. FAC+. [SGM] 

Lycopus americanus Muhl. OBL. [EM] 

L. virginicus L. OBL. [SDF] 
"Mentha ^.piperita L. FACW+. [SGM] 

Physostegia virginiana (L.) Benth. FAC + . [SSG] 
"Prunella vulgaris L. FACU. [SGM] 

Pycnanthemum tenuifolium Schrad. FACW. [SDF] 

Scutellaria elliptica Muhl. NC. [SDF] 

Scutellaria lateriflora L. FACW+. [SDF] 

Stachys nuttatlii Schuttw. FAC. [SGM] 

S. tenaifolia Willd. FACW+. [SDF] 

Teucrium canadense L. FACW—. [SDF] 

Trichostema dichotomum L. NC. [SGM] 
Lauraceae 

Lindera benzoin (L.) Blume. FACW-. [WM] 
Lemnaceae 

*Lemna minor L. OBL. [VOW] 
Liliaceae 
"Allium vineale L. FACU-. [SGM] 

Lilium canadense L. FAC + . [SGM] 
Linaceae 

Linum medium (Planch.) Britt. FACU. [SDF] 

L. striatum Walt. FACW. [SDF] 
Lythraceae 

Ammannia coccinea Rottb. OBL. [SDF] 
*Lythrum salicaria L. FACW+. [SGM] 

Rotala ramosior (L.) Koehne. OBL. [SDF] 
Magnoliaceae 

Liriodendron tulipifera L. FACU. [SS] 
Melastomataceae 

Rliexia virginica L. OBL. [SDF] 
Molluginaceae 
*Mollugo verticillata L. FAC. [SDF] 



— 


() 


— 


F 


1 





— 


— 





F 


— 





1 





1 


O 


— 


— 





— 


— 


F 


() 

1 


1 


— 


I 


1 


1 


— 


F 


— 


— 



O 



I 



— 


— 


— 


— 


I 


I 


o 


o 


O 


I 


I 


o 


o 


o 


O 


— 


— 


R 


o 
1 
o 


— 


— 


— 


— 


R 

F 


o 


F 


o 


F 


— 


I 


I 


o 


I 


I 


o 


I 


F 
I 


O 


I 


I 


R 


I 




— 


— 


— 


O 


— 


o 


o 


I 


F 


1 


— 


I 


— 


O 


— 


— 


— 


— 


R 


— 


I 


o 


R 


O 


I 


o 
I 

I 


F 


— 


O 


R 


O 


O 


F 
I 
R 

R 

I 


— 


R 



I 


I 


— 






1 





I 


I 
R 


— 


— 


— 


I 


I 








O 


F 


F 


o 


— 


— 


— 


R 


— 


R 
R 
I 


I 


— 





F 


I 


O 


I 


O 


O 


— 


O 


— 


o 


— 


_ 








o 






Flora <>l Five Reservoirs in the Berea College Foresl Thompson and Fh 



mine. 



129 



Appendix. < lontinued, 



Tilwhi. National Wetland Category [wetland habitat] 





lie 




m 




use 


LSC 


dill 


OFB 


I'.l.li 


( 1 


( ) 


F 


F 




F 


F 

I 


A 

1 


A 

1 


F 


o 


F 


I 


R 

() 
o 


1 

R 
F 


o 


F 

H 


F 


F 


I 


R 
R 

O 


R 


R 


— 


o 

I 





I 




O 


1 


1 


o 


O 

1 
I 


o 


o 


I 
R 


— 


o 


o 


— 


R 
I 


o 
o 

R 

I 

o 

I 
I 
o 

I 
I 


— 


I 


I 
I 
I 


I 

I 





I 


R 


I 


I 


o 
o 

F 


O 


o 


o 


o 


F 


F 


o 


o 


F 


O 


— 


o 


F 


A 


F 


A 
O 
F 


F 


, i 


F 





O 


I 


F 


F 


F 





— 


O 


I 


I 


— 


F 


F 


F 


F 

I 
F 


F 

1 
O 




F 





O 


F 


O 


F 


1 


— 


I 


o 


F 


1 
1 

o 





O 


o 


F 


R 


o 


— 


1 


I 


— 


1 


R 


O 

I 

o 


— 





o 









Najadaceae 
*Najas minor AH. OBL. [VOW] 

N. guadelupensis (Sprcng.) Magnus. OBL. [VOW] 

Fraxinus pennsylvanica Marsh. FACW. |SS] 
Onagraceae 

Circaea lutetiana L. FACU. [SGM] 

Epibbium colomtum Bi.-liler. FACW+. [SDF] 

Ludwigia alternifolia L. FACW+. [SDF] 

/.. decurrens Walt. OBL. [EM] 

L. palustris (L.) Ell. OBL. [SDF] 
Orchidaceae 

Habenariaflava (L.) R. Br. FACW. [SGM] 

II lacera (Michx.) Loud. FACW. [SGM] 

H. peramoena A. Gray. FACW. [SGM] 

Spiranthes cernua (L.) Rich. FACW. [SDF] 

S. lacera (Raf.) Raf. FACU-. [SGM] 
PJantaginaceae 

Plantago rugelii Dene. FACU. [SGM] 
Platanaceae 

Platamis orcidentalis L. FACW-. [SS] 
Poaceae 
*Agrostis gigantea Roth. FACW. [SDF] 

A. perennans (Walt.) Tuckerm. FACU. [SGM] 

Andropogon oirginicus L. FACU. [SGM] 

Brachyelytrum erectum (Schreb.) Beauv. NC. [SGM] 

Cinna arundinacea L. FACW+. [SDF] 
*Digitaria ischaemum (Schreb.) Muhl. UPL. [SDF] 
*D. sanguinalis (L.) Scop. FACU-. [SDF] 
*Echinochloa crus-gaUi (L.) Beauv. FACU. [SDF] 

E. muricata (Beauv.) Fern. FACW+. [SDF] 
*Eleusine indica (L.) Gaertn. FACU-. [SDF] 

Elymus htjstrix L. UPL. [SSG] 

E. oirginicus L. FACW-. [SDF] 
*Efagrostis pectinacea (Michx.) Nees. FAC. [SDF] 
*E. spectabilis (Pursh) Steudel. UPL. [SGM] 
*Festuca elatior L. FACU-. [SGM] 

Glyceria striata (Lam.) Hitehc. OBL. [EM] 
*Holcus lanatus L. FACU. [SGM] 

Leersia onjzoides (L.) Swartz. OBL. [EM] 

L. virginica Willd. FACW. [SDF] 
*Microstegium oimineum (Trin.) Camus. FAC. [SSG] 

Muhlenbergia frondosa (Poir.) Fern. FAC. [SSG] 

Panicum anceps Michx. FAC. [SGM] 

P. clandestinum L. FAC + . [SDF] 

P. dichotomiflorum Michx. FACW-. [SDF] 

P. dichotomum L. FAC. [SDF] 

P. flexile (Gattinger) Scribn. FACU. [SDF] 

P. lanuginosum Ell. FAC. [SDF] 

P. polyanthes Schult. FAC. [SDF] 

P. rigidulum Nees. FACW+. [EM] 

P. verrucosum Muhl. FACW. [SGM] 

Paspalum laeve Michx. FAC + . [SGM] 
*Setaria faberi Herrm. UPL. [SGM] 

S. geniculata (Lam.) P. Beauv. FAC. [SGM] 
*Sorghum halepense (L.) Pers. FACU. [SDF] 

Tridens flams (L.) A. Hitehc. FACU. [SDF] 
Polygalaceae 

Tolygala ambigua Nutt. UPL. [SGM] 

P. sanguinea L. FACU. [SGM] 



130 journal ol the Kentucky Academy ol Science 65(2) 

Appendix. Continued. 



Relative abundam 



T.l\<iii National Wetland Category, [wedand habitat] 



Polygonaceae 

Polygonum amphibium L. OBL. [EM] F F () 

*P. cespitosum Blumr. var. longisetum (De Bruyn) Stewart 

FACU-. [SDF] I O O F I 

P. densiflorum Meissn. OBL. [EM] I 

P. hydropipewides Michx. OBL. [EM] ( I 

P. lapathifolium L. FACW+. [SDF] H I 

P. pensylvanicum L. FACW. [SDF] I O O 

*P. persicaria L. FACW. [EM] O I I 

P. punctatum Ell. OBL. [SDF] I O O <) 1 

P. sagittatum L. OBL. [SDF] O O O — 

P. scandens L. FAC. [SDF] — — — O — 

P. tiirginianum L. FAC. [SDF] I I R 

*Rumex crispus L. FACW. [SDF] I O 1 

Potamogetonaceae 

Potamogeton. diversifolius Raf. OBL. [VOW] R 

P. iUinoensis Morong. OBL. [VOW] F — 

P. nodosus Poir. OBL. [VOW] F A F A A 

P pusilhis L. OBL [VOW] I — 

Primulaceae 
*Lysimachia nummularia L. FACW+. [SGM] F 

Samolus floribundus HBK. OBL. [SDF] I I O O R 

Ranunculaceae 

Clematis oirginiana L. FAC. [SDF] R O I F O 

Thalictrum pubescens Pursh. FACW+. [SGM] I 

Rosaceae 

Agrimonia parviflora Ait. FACW. [SGM] IF A F 

A. rostellata Walk. FACU. [SGM] — I — I — 

Geum canadense Jacq. FACU+. [SGM] II OR 

Potentilla norvegica L. FACU. [SGM] O 

Rubus pensilvanicus Poir. FACU. [SGM] O O F I 

Rubiaceae 

Diodia virginiana L. FACW. [SDF] O F 

Galiii7n tinctorium (L.) Scop. OBL. [EM] — F — 

G. triflorum Michx. FACU. [SGM] I O I O R 

Salicaceae 

Populus deltoides Marsh. FAC. [SS] R 

Salix exigua Nutt. OBL. [SDF] I F 

S. nigra Marsh. FACW+. [SS] I F I F O 

S. sericea Marsh. OBL. [SS] O O 

Saxifragaceae 

Penthorum sedoides L. OBL. [SDF] O O O F I 

Scrophulariaceae 

Agalinis purpurea (L.) Pennell. FACW-. [SGM] O I 

Gratiola neglecta Torr. OBL. [SDF] R 

Leucospora multifida (Michx.) Nutt. OBL. [SDF] R 

Lindernia dubia (L.) Pennell. var. anagallidea (Michx.) Cooperri- 

der. OBL. [SDF] I O O F I 

Mimulus alatus Ait. OBL. [SGM] O O O O I 

M. ringens L. OBL. [SGM] R I F I 

Sparganiaceae 

Sparganium americanum Nutt. OBL. [EM] — A 

Typhaceae 

Tijpha angustifolia L. OBL. [EM] 
T. latifolia L. OBL. [EM] 

Urticaceae 

Boehmeria cylindrica (L.) Sw. FACW+. [SDF] 
Laportea canadensis (L.) Wedd. FAC. [SDF] 
Pilea pumila (L.) A. Gray. FACW. [SDF] 












F 




— 


A 


F 


A 


F 


o 


F 


O 


F 


I 


I 


— 


I 







o 


O 


I 


F 


I 



Mora (il Five Reservoirs in the Berea College Forest —Thompson and Fleming I i 1 

Appendix. ( lontinued 



Rclativi kbund 



Taxon Not al Wetland Categpiy [wetland habitat] 



Clllt OFR 



HI.H 



Verbenaceae 

Verbena urticifolia L. FACU. [SGM] 
Vitaceae 

Ampelopsis cordata Michx. FAC+. [SDF] 

Parthenocissus quinquefolia (I..) Planch. FACU. [SDF] 

\ itis mtlpina L. FAC. [SDF] 

Totals 



— 


— 


— 


() 


— 


() 


1 


() 


() 


() 


1 


() 


1 


() 


1 



II I 



177 



150 



2U 



135 



abbreviations and acron) ms used: 
Bi n ■ ( ollege Reservoirs: CBR = Cowbell: LSC = Lower Silver Creek; OFR = Owsley Fork RLR = Red Ucl No 2 I S< 
National Wetland Categories: FAC = Facultative; FACU - Facultative Upland FACM Facultative Wetland; OBI Obligati Nl Notl iti ■ 

UPL - Upland; + - Wetter limit of facultative categories; - = Drier limit of facultative categories. 
Reservoir Wetland Habitats: KM = Emergent Marsh: SDF = Seasonally Dewatered Mud-sand Flats SGM Sedgi era ; Mi idow ss Shrul 

ns< . -- Shallow Stream with Gravel Bar; VOW = Vegetated Open Watei 
Relative abundance: R - Rare: 1 - Infrequent: O — Occasional; F - Frequent; \ - Vbundanl 



J K) Vcad. Sd SS(2 132 139. 2<HM 

Natural Terrestrial Vegetation of Boone County, Kentucky: 
Classification, Ordination, and Description 

William S. Bryant 

Department of Biology. Thomas More College, Crestvie\» Mills. Kentuck) 41017 

Shannon L. Galbraith 
Department of Ecology and Evolution. Rutgers University, New Brunswick. New Jersey 0S901 

and 

Michael E. Held 
Department of Biology. Saint Peters College, Jersey City, New Jersey 07306 

ABSTRACT 
Seventeen mature forests and one prairie in Boone Counts', Kentucky, were systematic-alls sampled and 
subjected to cluster analysis and ordination. Eight vegetation or community rspes were identified: mixed 
mesophytic (glacial), mixed mesophytic (steep allusial). beech, beech-maple, oak-hickorv. oak-ash-maple (or 
western mesophytic), floodplain, and prairie. Environmentally, the vegetational patterns observed in the 
county appear to follow moisture and topographic/soils gradients. Also, differences in glacial and edaphic 
history appear to strongly influence tree species community patterns. 



INTRODUCTION" 

Geologically and edaphicallv. Boone Counts" 
is unlike most of Kentucky. Although bedrock- 
consists of limestone and calcareous shale of 
Ordovician age, it is the presence of outsvash 
deposits of Nebraskan. Kansan, and Illinoian 
glaciatdons plus a loess cover of Wisconsin age 
(Ray 1974) that largely accounts for diese dif- 
ferences (Figure 1). These deposits cover ca. 
half of die county's 64,578 hectares. Locally, 
the glacial deposits vary in thickness or are ab- 
sent where thev have been removed bv ero- 
sion. Soils in die count)" are nearly equally di- 
vided between diose of residual origin or 
those of transported origin — glacial, loessial. 
alluvial, and colluvial (Weisenberger et al. 
1973) (Table 1). 

Historically, nine natural areas were listed 
for Kentucky (Middleton et al. 1926) in Nat- 
uralist's Guide to the Americas; the two in 
Boone County were areas with glacial depos- 
its. Later, Keidi (1968) attempted to charac- 
terize the vegetation on some of die glacial 
deposits in die counts". Held and Winstead 
! 1976 ) reported on a forest on pre-Illinoian 
deposits, and Brvant (1978) analyzed a forest 
on Kansan outsvash deposits there. Brvant 
(1981a) described forests of the unglaciated 



Eden Shale Belt, which covers much of die 
soudiem half of the county-, and also a small 
prairie outlier on a Kansan deposit (Brvant 
1981b). At present, ca. 38% of the land area 
of Boone County is forested (ERMC 2002). A 
majority of the existing woodland is composed 
of voung successional stages —50 vears in age; 
however, 11% and 2% of die land area is in 
medium to large-crown canopy cover, respec- 
tively (ERMC 2002). 

The climate of Boone Counts" is temperate 
and humid. The average annual temperature 
is about 12.2°C, and die average precipitation 
is about 101.6 cm per year (Elam 1973). There 
are no regular wet or dry seasons; precipita- 
tion is fairly well distributed throughout die 
year (Elam 1973). 

For over 30 vears we have been systemati- 
cally sampling die natural vegetation in Boone 
County, especially those areas with large 
crown cover (ERMC 2002). The objectives of 
this paper were (1) to classify- die natural veg- 
etation of die county, (2) to compare vegeta- 
tion-environmental relationships, especially 
die influence of soils and glacial history on 
vegetation, and (3) to document die vegetation 
in a portion of the Greater Cincinnati area 
(Boone Counts) diat is experiencing a rapidly 



132 



Vegetation <>l Boone County — Bryant Galbraith, ami Held 



133 




H«w U .. t\ 



\G ^J^7'«^\-f. 



Figure 1. A glacial map of Boone County, Kentucky, and the Greater Cincinnati region showing the extent of drift 
deposits (after Ray 1974). 



increasing human population and subsequent 
changes in land use. 

METHODS AND MATERIALS 

In general, trees at all sites were sampled 
in 0.04 ha circular plots spaced at 30 m inter- 
vals along line transects throughout each for- 
est. Two stands were sampled using plotless 
methods, and the prairie was sampled in 1 m 
X 1 m plots (Bryant 1981b). We sampled 17 
mature forests plus one prairie site from 
across Boone County; however, one of the for- 
est sites was located in adjacent Kenton Coun- 
ty (Figure 2). 

Onlv trees ^10 cm diameter breast height 
(dbh) were measured; however, in two stands 
die minimum dbh was &S.9 cm. Although 
shrubs, seedlings and saplings, and herbs were 
sampled in most stands, only overstory was 
considered in the forest analysis for this paper. 
These data were analyzed to relative frequen- 
cy (RF), relative density (RD), and relative 
dominance (RDo), which were then summed 



to generate an importance value (IV) for each 
species (Curtis and Mcintosh 1951). Densitv 
(trees/ha), total basal area (m2/ha), and species 
diversity (H') were calculated for each forest. 
Grasses and forbs in the prairie were analyzed 
to frequency onlv (Brvant 1981b). 

Classification of stands was developed using 
an unweighted pair-group mean-average 
(UPGMA) cluster analysis with percent simi- 
larity (Kovach 199S). A cutoff value of 60% 
similarity was used to create the initial cluster 
groupings (Hinkle 197S). This analysis was 
performed on untransformed importance val- 
ue data, which included all species. Stand re- 
lationships were summarized using the Bray- 
Curtis ordination procedure (McCune and 
Medford 1999). 

RESULTS 

Fortv-four tree species were recorded for 
Boone County, 38 from our samples plus 6 
from Keith (1968). Tree density, basal area, 
tree species diversity, and tree species richness 



134 



Journal ot the Kentucky Academy <>l Science 65(2) 



Table 1. The- percentage '' "I land in Boone County, 
Kentucky with residual and transported soils. Tile total 
percentage does not equal 100 since only soil types for 
sampling sites are listed. Also the range of slope for each 
soil type is included. 



Slope 


Residual soils 






Eden siltv clay loam 
Cynthiana flaggy' silty clay loam 
Faywood siltv clay loam 
Total' 


19.0 

8.8 
13.9 

41.7 


12-35 
12-50 

2-20 


Transported soils 

Glacial (loess over glacial till) 






Rossmoyne silt loam (fragipan) 
Jessup silt loam (no fragipan) 


23.1 
14.5 


0-12 
2-20 


Loess (loess over residuum) 






Nicholson silt loam 
Alluvial land, steep 
Lakin loamy- fine sand 


7.9 
1.4 
0.6 


0-12 
0-12 


Alluvium 






Lindside silt loam 
Nolin silt loam 
Huntington silt loam 
Total 


0.9 
1.1 

1.2 
50.7 


0-4 
0-4 
0-4 



for each stand are shown in Table 2. Based on 
cluster analysis, we were able to recognize 
three vegetation types: (1) mixed mesophvtic 
(glacial), (2) oak-hickorv, and (3) oak-ash-ma- 
ple (Figure 3). All five of the mixed meso- 
phvtic (glacial) stands clustered together at 
>60% similarity as did two oak-hickorv stands 
and two oak-ash-maple stands. Other vegeta- 
tion types apparently were represented bv 
only one stand each and did not show cluster- 
ing. 

In an attempt to determine vegetation-en- 
vironmental relations, all stands were ordinat- 
ed. Axis 1 of the ordination appeared to be a 
moisture gradient with the prairie at the drier 
end and the floodplain forest at the wetter end 
(Figure 4). The majority of stands tended to 
group near the middle of the moisture gradi- 
ent, perhaps reflecting the mesic nature of die 
county. Axis 2 was either a topographic or soil 
gradient, but may be a combination of die 
two. The beech forest was on a flat upland site 
with Jessup soil, die mixed mesophytic (steep 
alluvial) site was in a ravine widi sandy soils of 
Illinoian or glacioflmiatile origin (Ray 1974), 
and the beech-maple site was gendy rolling 
with Rossmoyne soil, which consists of Wis- 
consin loess over glacial till (Weisenberger et 



al. 1973). All mixed mesophytic ( glacial i sites 
were in highly dissected areas ot Kansan out- 
wash and Jessup soils. The oak-hickory sites 
were on gentle to moderate slopes with Fay- 
wood and/or Eden silt loams; the oak-ash-ma- 
ple sites were on steep slopes with Cynthiana 
silt loams. The latter three soil types are re- 
sidual. 

DESCRIPTION OF VEGETATION 

Mixed mesophvtic forests were of two 
t\pes, those on Kansan glacial deposits and 
others on steep alluvium. The mixed meso- 
phytic glacial sites (BC, BN, BP, MU, YP; 
codes for sites are explained in Figure 2) xvere 
on highly dissected outwash deposits of Kan- 
san age. Seeps and springs were characteristic 
of these sites. Dominant tree species included 
sugar maple (Acer sacchamm), white ash 
(Fraxinus americana), beech (Fagus grandi- 
folia), bassvvood (Tilia americana), northern 
red oak (Quercus rubra), bitternut hickory 
(Carya cordifonnis) , and tulip poplar (Liriod- 
endron tulipifera). Tree species diversity (H') 
ranged from 2.6 to 3.5 (Table 2) and these 
sites are floristically rich (Bryant 1978). Tree 
density ranged from 222 to 499 trees/ha, and 
basal areas fit die >25 m 2 /ha proposed bv 
Martin (1992) for mature mixed mesophvtic 
forests. 

Mixed mesophvtic (steep alluvium) forests 
are found in ravines (SC) with steep alluvial 
soils. These sandy soils are found within die 
narrow band of Illinoian glacial deposits near 
die Ohio River in the western portion of the 
county (Figure 1). Tulip poplar was the dom- 
inant species at this site and also at a sandv 
hummock site (HS); however, vegetation at 
that site tended to ordinate more closely to 
beech-maple than to the mixed mesophvtic 
(glacial) stands. 

Oak-hickory forests (DU, WS) were associ- 
ated with the droughty residual Fawvood or 
Eden soils, although other soils, e.g., Nichol- 
son, were of minor importance. Those stands 
were located on side slopes and narroxv ridges, 
especially- widiin the Eden Shale Belt portion 
of Boone County. White oak (Quercus alba), 
northern red oak, and shagbark hickory (Car- 
ya ovata) were canopy dominants. On such 
sites sugar maple was primarily a subcanopy 
member (Bryant 1981a). Odier stands (LW, 
MM, DW) showed similarities to oak-hickory, 



Vegetation ol Boone County — Bryant, Galbraith, and Held 



135 




Figure 2. Location of sampling sites in Boone County, Kentucky. Site abbreviations: BC, Boone County Cliffs Nature 
Preserve; BM, Beech-Maple; BN, Boone County Cliffs Addition; BP. Bald Point; DU, Durrs Woods; DW, Dinsmore 
Woods; EB, East Bend; EC, Elijah Creek; GC, Gunpowder Creek; HS, Hummock Site; KP, Kansan Prairie; LW, 
Luebber's Woods; ML, Middle Creek Floodplain; MM, Middle Creek Middle Slope; Ml!, Middle Creek Upper slope; 
SC, Steep Creek; WS, Woodland-Scott (located in adjacent Kenton Count)); and VP, Young Property. Open circles 
represent Keidi's (1968) sample sites; closed circles show location of some towns in Boone Countv. 



but other oak species, not white oak, were of 
greater importance. 

Oak-ash-maple communities (EC, GC. 
DW) occupied moderate to steep slopes, es- 
pecially where erosion had removed much or 
all of the former till deposits. Cvnthiana silt 
loam was the principal soil type and the forest 
dominants were oaks (Quercus spp.), white 
ash, and sugar maple. Because of composi- 
tional similarities, it was often difficult to dis- 
tinguish oak-hickorv and oak-ash-maple 
stands. 

Beech-maple (BM) forests yvere most 



prominent on the level to gently rolling up- 
lands with Rossmovne soils. These loessial 
soils are underlain by a fragipan that may hin- 
der drainage. Beech (EB) forests were also 
found on gentlv rolling uplands, but there Jes- 
sup soil is most prominent. Both lorest types 
had low tree densities, but high basal areas 
(Table 2). 

Floodplain forests were dominated by box- 
elder (Acer negundo), cottonwood [Papains 
deltoids), and silver maple (.4. saccharinum . 
These forests are located on wide creek banks 
and Ohio [liver backwater sites. The alluvial 



36 



journal ol the Kentuck) Academ) of Science 65(2) 



KP 

ML 



BM 
SC 





| 




LW 




__ 




M 




























1 




H 








L 












H 














I w 




1 BP 






BC 



-20 



20 



40 



60 



80 



100 



Percent Similarity 

Figure 3. Dendrogram based on cluster analysis, showing the relationship of the sites sampled in Boone County, 
Kentucky. 



CM 

tn 
x 
< 







GC 








DW 
DU " 


EC 








WS" LW 










MM- * BC 










YP 




HS 






BP 










BH „ MU 








KP 


BM 
SC 

EB 






ML 



Axis 1 

Figure 4. Ordination of the 18 sites sampled in Boone County. Axis 1 is a moisture gradient; a\is 2, a topographic/ 
soils gradient. 



Vegetation ol Boone C -oiint\'— Bn/aitl. C.alliniilli. rind Held 



13' 



Table 2. Tree density (trees/ha), basal area (m 2 /ha), spe 
cies diversity (H'l. and the number of tree species for 
forests .mil other environs in Boone County. Keiilnrkv 
Site abbreviations as in Figure 2. 











Smith's richness 
(number «»! tree sjm tics i 


Forest site 


ha 


m ha 


II' 


BC 


499 


27.S 


3.2 


25 


BN 


390 


28.3 


2.6 


IS 


BP 


410 


38.4 


3.5 


20 


MU 


262 


24.7 


2.1 


12 


YP 


222 


27.1 


3.2 


23 


SC 


302 


46.0 


3.7 


20 


IIS 


296 


36.2 


2.8 


16 


BM 


233 


32.6 


3.0 


18 


EB 


126 


35.4 


2.0 


8 


ML 


538 


26.7 


0.9 


9 


DU 


470 


23.1 


2.3 


17 


WS 


343 


31.4 


2.1 


13 


I.W 


347 


26.6 


1.4 


11 


MM 


314 


21.5 


3.0 


17 


DW 


334 


28.1 


3.2 


22 


EC 


328 


22.4 


3.0 


14 


GC 


457 


29.6 


2.8 


16 


KP 















soil complex included Lindside, Nolin, and 
Huntington silt loams. Species diversity at the 
wet end of the moisture gradient was lower 
than for mesic and drv-mesic sites. 

Prairie communities (KP) were rare; occur- 
ring as small isolated patches on exposed gla- 
cial outcrops or upland sand deposits (Bryant 
1981b). Little blustem (Schizachyrium scopar- 
ium), side-oats grama (Bouteloua curtipendu- 
la), and Indian grass (Sorglwstmm nutans) 
were characteristic of these drier sites al- 
though a number of forbs were relatively 
abundant. Seedlings of eastern redcedar (Jun- 
iperus virginiona) appeared to be slowly in- 
vading the prairie. 

DISCUSSION 

There have been few recent reports or de- 
scriptions of countvwide (e.g., Campbell and 
Grubbs [1992] for Hopkins County) or region- 
al vegetation (e.g., Bryant and Held [2001] for 
the Jackson Purchase Region) in Kentucky. 
However, Bryant and Held (2004) recently de- 
tailed the vegetation-environment patterns in 
Hamilton County, Ohio. Geologically, Boone 
and Hamilton counties have experienced sim- 
ilar glacial events; phytogeographicallv, these 
two counties are located in the northern por- 
tion of Braun's (1950) Western Mesophvtic 
Forest Region but near the junction of her 



Mixed Mesophytic, Oak-Hickory, and Beech- 
Maple Fores! Regions. 

The structure and composition of vegeta- 
tion are determined l>\ a nber of factors 

including past disturbances, successional pro- 
cesses, and individualistic responses of species 
to environmental constraints (Cole and Ware 
1997). A number of. species respond similarih 
to environmental gradients and thus sort oul 
as communities or vegetation types. 

The beech-maple and beech forests that we 
identified may represent remnants of forest 
types that formerly were more widel) distrib- 
uted on Rossmoyne soils in Boone and adja- 
cent Kenton counties, Kentuck) (Keith L968). 
Beech-maple forests were reported on soils of 
mixed glacial origins in Hamilton County, 
Ohio (Bryant 1987; Bryant and Held 2004) 
and were found on Illinoian deposits well 
south of the Wisconsin glacial border in In- 
diana (Lindsey et al. 1965). Braun (1950) and 
Vankat et al. (1975) considered the terminus 
of the Wisconsin advance in southern Ohio to 
be the southern extent of beech-maple forests. 

Bryant and Held (2004) reported two hpes 
of mixed mesophytic forests in Hamilton 
County, one with tulip poplar and one with- 
out. We also found two tvpes of mixed meso- 
phytic forests in Boone Count)' — one on high- 
ly dissected Kansan outwash deposits (Bryant 
1978) and one on steep alluvium. Although 
Keith (1968) considered tulip poplar to be 
scarce in Boone County, it was common in 
both mesophvtic tvpes and was a dominant on 
the steep alluvium. In soutiiern Ohio, Forsvth 
(1970) noted diat mixed mesophvtic forests 
containing buckeye, beech, white basswood. 
and tulip tree appeared to correlate with die 
occurrence of Kansan drift. A great variety of 
moisture conditions exists in these deep, 
steep-sided valleys (Forsvth 1970) and sup- 
ports a mixed mesophvtic association. 

We found the floodplain forests in Boone 
Count)' to be eompositionallv similar to those 
in Hamilton Countv. Boxelder, Cottonwood, 
and silver maple, along with green ash (F. 
pennsylvanica) and various willows {Salix 
spp.), vary in importance in different parts of 
die floodplains. 

Oak-hickory forests were lound primarily on 
steep slopes and ridges with droughty residual 
soils. Keith (1968) speculated that white oak 
had been more important in the past than at 



138 



il of tlic Kentucky Academy ol Science 65(2) 



present. In the Eden Shale Belt, white o;ik is 
generally more important in stands where dis- 
turbance has been minimal (Bryant 1981a), 
but its importance was reduced on previously 
logged sites. This may support Keith's (1968) 
speculation; however, slope aspect may influ- 
ence the occurrence of white oak. On less ex- 
posed aspects, more mesic species are of 
greater importance. 

Oak-ash-maple stands were most commonly 
found on steep slopes in those areas of the 
count)' where erosion had removed the former 
glacial cover. In Hamilton Count}-, Ohio, Bry- 
ant and Held (2004) referred to this forest 
type as western mesophvtic after Gordons 
(1966, 1969) recognition of western meso- 
phvtic forests in southern Ohio. 

Prairies, although extremely small in areal 
extent, add an important component to the 
county's vegetational diversity. These prairie 
remnants have been maintained by a complex 
of factors including periodic disturbances 
(Bryant 1981b). 

SUMMARY 

The broad vegetational development shown 
for Boone County might not be expected on 
a local level (i.e., one count} 7 ); however, geo- 
logic and edaphic diversity 7 underlie and pro- 
mote biological diversity here. In adjacent 
Hamilton County, Ohio, Bryant and Held 
(2004) found forest types to sort out along 
moisture and topographic gradients. We found 
a similar pattern in Boone County but perhaps 
widi a stronger influence from soils, especially 
in relation to glacial and postglacial history. A 
mosaic of unlike climaxes is characteristic of 
the Western Mesophvtic Forest Region 
(Braun 1950); we, too, found a mosaic of veg- 
etation types. Braun (1950) considered the 
Western Mesophvtic Forest Region to repre- 
sent a tension zone where the compensating 
effects of local environments permit unlike cli- 
maxes to exist close to one another. We sup- 
port that tension zone interpretation for 
Boone County, especially considering its geo- 
graphic location and glacial-edaphic history. 

LITERATURE CITED 

Braun, E. L. 1950. Deciduous forests of eastern North 
America. The Blakiston Co.. Philadelphia, PA. 

Bryant. W. S. 1978. Vegetation of the Boone County - Cliffs 
Nature Preserve, a forest on a Kansan outwash deposit 



in northern Kentucky. Trans, Kentucky Acad. Sci, 39: 
12-22. 
Bryant, W. S. 1981a. Oak-hickor) forest of the Eden Shale 
Belt: a preliminary report. Trans. Kentucky Acad Si i 

42:41-15. 
Bryant, W S. L9811). Prairies on Kansan outwash deposits 

in northern Kentucky. Ohio Biol. Surv. Biol. Notes 15 
8,8-91. 

Bryant. W. S. 1987. .Structure and composition of the old- 
growth forests ol Hamilton County, Ohio and environs. 
Pages 317-324 in R. L. Hay, F. W. Woods, and II. 
DeSelm (eds). Proc. Sixth Centra] Hardwoods Forest 
Conference. University of Tennessee, Knoxville, TN. 

Bryant, W. S., and M. E. Held. 2001. An ordination of the 
plant communities of the Jackson Purchase flegion of 
Kentucky*. Pages 11-18 in E. W. Chester and A. F. Scott 
(eds). Proc. Ninth symposium on the natural history of 
Lower Tennessee and Cumberland River vallevs. The 
Center for Field Biology, Austin Peay- State University. 
Clarksville, TN. 

Bryant, W. S., and M. E. Held. 2004. Forest vegetation 
in Hamilton County, Ohio: a cluster analysis and ordi- 
nation study. Pages 312-321 in Proc. 14th Central 
Hardwood Forest Conference. GTR-NE-316. 

Campbell, J. J. N., and J. Grubbs. 1992. Natural plant 
communities of Hopkins Counts, Kentucky. Trans. Ken- 
tucky Acad. Sci. 53:29-38. 

Cole, A. M., and S. A. Ware. 1997. Forest vegetation, 
edaphic factors, and successional directions in the cen- 
tral Piedmont of Virginia. Castanea 62:100-111. 

Curtis, J. X, and R. P. Mcintosh. 1951. An upland forest 
continuum in the prairie-forest border region of Wis- 
consin. Ecology 32:476-496. 

Elam, A. B„ Jr. 1973. Climate. Pages 63-64 in B. C. Wei- 
senberger, C. W. Dowell. T R. Leathers, H. B. Odor, 
and A. J. Richardson (eds). Soil survey of Boone, Camp- 
bell, and Kenton counties, Kentucky. U.S.D.A. Soil 
Conservation Service. Government Printing Office, 
Washington, D.C. 

[ERMC]. Environmental Resource Management Center. 
2002. Boone County Forest Quality Assessment: an 
ecological evaluation, prioritization, and mapping. RPt: 
1090. 

Forsvth, J. L. 1970. A geologist looks at die natural veg- 
etation of Ohio. Ohio J. Sci. 70:180-191. 

Held, M. E., and J. E. Winstead. 1976. Structure and 
composition of a climax forest system in Boone County, 
Kentucky. Trans. Kentucky Acad. Sci. 37:57-67. 

Hinkle, C. R. 1978. The relationship of forest communi- 
ties and selected species to edaphic and topographic 
factors on the Cumberland Plateau of Tennessee. Ph.D. 
Dissertation. University of Tennessee, Knoxville, TN. 

Gordon, R. B. 1966. Natural vegetation of Ohio, at die 
time of the earliest surveys [map]. Ohio Biological Sur- 
vey, Columbus, OH. 

Gordon, R. B. 1969. The natural vegetation of Ohio in 
pioneer davs. Ohio Biol. Bull. n.s. 3(2). 

Keith, J. R. 1968. Vegetation of the Pleistocene Drift Re- 



Vegetation of Boone County — Bn/aul. Galbraith, anil Held 



139 



gion, northern Kentucky Trans. Kentucky Acad. Sci. 29: 
1O-20. 

Kovach, W. L. 1998. MVSP— a multivariate statistical 
package for Windows. Version '>.(). Kovach Computing 
Services. Pentraeth, Wales. U.K. 

Lindsey. A. A.. W. B. Crankshaw, and S. A. Qadir. 1965. 
Soil relations and distribution map ol vegetation ol piv- 
settlement Indiana. Bot. Gaz. 126:15.5-163. 

Martin. W. II. 1992. Characteristics of old-growth mixed 
mesophytic forest. Nat. Areas J. 12:127-135. 

McCune, B., and M J Medford. 1999. PC-ORD for Win- 
dows (Version 4.17): multivariate analysis ol ecological 
data. MJM Software. Gleneden Beach. OR. 

Middleton. A. R.. W. R. Jillson. F. T. McFarland. and W. 



V Vnderson 1926 Kentucky. Pages 349 154 in \ I 
Shelford (ed Naturalist's guide to the vmericas The 

William', ami Wilkins Co Baltimore, Ml) 
Ray, L. I.. 1974. Geomorpholog) and quaternary geolog) 
ol the glaciated Ohio River Valle) — a reconnaissance 
stud). U.S. Geol. Sun. Professional Paper S2b. 
Vankat, J. I... W II. Blackwell, and W. E. Hopkins 1975 
The dynamics of Hueston Woods and a review "I the 
question of the successional status of the southern 
beech-maple forest. Castanea 40:290-308. 
Weisenberger, If C, E. W. Dowell, T. R. Leathers. II. B. 
Odor, and A. J. Richardson. 1973. Soil surve) of B( 
Camphell and Kenton counties. Kentucky. U.S.D.A. 
Soil Conservation Sen ice Government I'rintiiig Office 
Washington, DC. 



J. Ky. Acad. Sci. 6S(2):140-153. 2004. 



Scientists of Kentucky 



Christopher Columbus Graham: Kentucky Man of Science 

James Duval] 
Boone County Public Library, Scheben Branch, 8899 U.S. 42. Union, Kentuck) 41091 



Christopher Columbus Graham (1784- 
1885) was bom in Kentucky before it became 
a state. He was considered one of the most 
interesting and useful citizens in the state long 
before die time of his death at the age of 100. 
Though he was a man concerned in public af- 
fairs and a self-made man of wealth, he never 
held a public office. He was a traveler, writer, 
archaeologist, medical doctor, civic leader, and 
philanthropist. 1 In die larger historical picture 
his scientific contributions must be considered 
negligible, but he participated in the scientific 
life of die time and might be considered char- 
acteristic, as there were very few men then 
who could be considered professional scien- 
tists. 

As a woodsman Graham had few equals. 
When a young man he made about 20 flatboat 
trips down the Mississippi. He was on die wa- 
ter near New Madrid, Missouri, during the 
great earthquake of December 1811. He de- 
veloped such facility with die rifle that he 
eventually came to be regarded as die best 
marksman in the world, and he could shoot 
with unaided vision to die age of 100. ' The 
skills he gained at this period of his fife were 
doubtless of value when he joined a company 
of infantry during the War of 1812. - He was 
wounded, captured, then exchanged, re-enter- 
ing active service. Later, at Fort Maiden, Can- 
ada, he was captured by Indians but soon es- 
caped. In 1814 he enlisted again. These were 
rough times, and not all of die fighting was 
with the enemy. For example, Lt. Chasteen 
Scott (1785-1861), under whom he served as 
a Sergeant, "whipped a rascally Yankee con- 
tractor [sic]" on 30 Oct 1814, the day that Gra- 
ham and the rest of the company were finally 
discharged from active service. 3 

Graham probably intended to return to his 
former occupation as a silversmith in which he 
had been occupied before the war. As he 
passed dirough Lexington, Kentucky, on his 
way back to Harrodsburg, he chanced to meet 



Dr. Benjamin Winslow Dudley (1785-1870) in 
Lexington. Dr. Dudley had received his M.D. 
at the University of Pennsylvania in 1806, and 
he had just returned from medical studies in 
England and France in 1814. He was to be 
particularly known for his success in operating 
for kidney and bladder stones; he is said to 
have operated on 225 such cases, all without 
benefit of anesthesia, losing only three pa- 
tients. He also performed successful cataract 
surgery. He opposed die use of bloodletting 
and was one of the first to sterilize his surgical 
instruments in boiling water. He is considered 
the founder of the medical school at Transyl- 
vania University in Lexington. Dudley, slightly 
younger than Graham, immediately offered 
him a chance to become one of his first stu- 
dents. Graham, just past die age of 30, was 
virtually uneducated, except in die ways of the 
woods, and war, and he told Dudley he lacked 
both the education and money to study at the 
university. Dudley replied he would keep the 
offer open till whenever it was wanted. 

After the war was over in the spring of 
1815, Graham made another trip to New Or- 
leans. There he accepted an offer from James 
Hull, D.D., rector of Christ Church, to teach 
school, which he did, just barely keeping 
ahead of the students. By this means he likely 
gained die remedial skills he needed for his 
future college career. An outbreak of yellow 
fever, so common in New Orleans at that time, 
forced him to leave the city. He took a ship to 
New York, but the ship had its own outbreak, 
and a number of the people on it died; Gra- 
ham was ill when he arrived. The ship was 
quarantined, but he hired a skiff, landed in 
Virginia, and walked back to Kentucky by way 
of the Cumberland Gap. He then accepted 
die offer to study with Dr. Dudley, a turning 
point in his life. 

In 1810 Transylvania University was one of 
six medical colleges in die nation; by 1820 that 
number had grown to 26. When Craham be- 



140 



Christopher ( lolumbus ( Jraham— Dm all 



111 




-"&. '^g^t^^L^r ^i^t/fl 



r 



IsOt^-*^*-*^ 



c5f~a^ v -* 



i s* 



Figure 1. Christopher Columbus Graham. From W. B. Alien. A History of Kentucky L872 



142 



Journal of 1 1 it- Kentucky Academy of Science 65(2) 



came a student of Dr. Dudley in 1817 it was 
still one of the best in the country. Graham's 
quick mind and unusual abilities were put to 
good use. This was the course of study, ac- 
cording to Wright: 

During this period requirements for the degree of 
doctor of medicine required a student to take two 
years of lecture courses, unless he had been a prac- 
ticing physician for four years, in which case he need- 
ed to attend only one year. All candidates had to be 
twenty-one years or older, write a thesis of not less 
dian twelve or more than forty pages on a designated 
medical subject, and pass two examinations, one be- 
fore the faculty and one before the president and 
trustees. The curriculum covered the areas of anat- 
omy and surgery, theory and practice of medicine, 
materia medico and medical botany, obstetrics, 
chemistry, and the institutes of medicine.' 1 

It has been remarked with some justifica- 
tion (though not entirely correctly) that Gra- 
ham did very little work in the profession in 
which he was trained. 5 With an associate, Dr. 
Henry Miller, he practiced medicine in Har- 
rodsburg for five years following his gradua- 
tion and did at least some medical work for 
years afterwards. He wrote a medical book in 
1866 titled The True Science of Medicine, ev- 
ery copy of which seems to have disappeared. 6 
He performed but one operation for kidney 
stones, and that successfully, on a small child. 7 
For over 30 years he was proprietor of Har- 
rodsburg Springs, the most famous "watering- 
place" in Kentucky at that time. 8 Louis Jacob 
Frazee, M.D. (1819-1905), writing on the 
medical uses of the mineral waters of the 
state, said: 

Thirty years ago the Harrodsburg Springs under 
the management of Dr. Graham, was one of the most 
popular watering places in Kentucky. The beautiful 
grounds, and the fine hotel accommodations pre- 
senting the most attractive features of the place. The 
most important ingredient of die water here, is sul- 
phate of magnesia, which renders it aperient, but 
aside from this it possesses no very decided medicinal 
virtues. It may be used in toipor of the bowels, es- 
pecially when accompanied with dyspeptic symp- 
toms, indeed in almost every case where a gende ape- 
rient effect is desired. This has long since been aban- 
doned as a watering place. 9 

No doubt Graham did at least some con- 
sultation during that time, which was probably 
a factor in the popularity of die springs as a 
place of healing. He had on his staff in die 



IS 10s Dr. E. B, Thomas, a hydrotherapist. 10 

The hydrotherapy department had been or- 
ganized by Dr. Roland S. Houghton of New 
York, a famous teacher ol hydrotherapy" 
VanArsdall, after a lengthy analysis of the 
treatment at Harrodsburg Springs, concluded, 
"It is obvious that Dr. Graham must have 
practiced a mild sort of psychotherapy in as- 
sociation with the baths and general hygienic 
measures." vl In his old age Graham is listed 
in the census records as a "Retired Physician," 
which gives credence to die idea that he con- 
sidered medicine his primary occupation. 

Psychology, then called mental philosophy, 
was an area in which Graham studied that may 
be considered an offshoot of his medical in- 
terests. His The true science of mind (1869), 
is a devastating critique of the current "mental 
philosophy," and it is also his own attempt at 
a positive contribution to the field. He wrote: 

My natural turn of mind led me, in early life, to 
moralize upon all events, and caused a pleasure (no 
self-creation, take notice) in me to do just as I 
pleased, which was to read everything I could find 
upon the subject of mind. With this foundation I 
commenced my practical study of mind, and having 
for more than fifty years mixed with all nations and 
languages of the human family, from the native In- 
dian up, or rather, down, to die snobs, parvenus, and 
paragons — the fashionable folly of our race — have 
sought to find where happiness dwells. 13 

Unlike practitioners of the discipline in our 
day, Graham tended to draw an overt moral 
from the material he discussed. He related the 
following incident (reminding us, perhaps, of 
Pavlov's dog) about his pet, Fidel: 

I here relate a little incident that illustrates two 
great leading principles: I had a sprightly and inter- 
esting puppy, to which the cook often threw egg- 
shells, thus teaching it to eat eggs; the result being 
the breaking up of all my setting hens and loss of 
chickens. All this, however, my fond attachment in- 
duced me to put up with; but another branch of ed- 
ucation caused its death. Breachy sheep occasionally 
entering my yard, I set little Fidel after them, and 
was often greatly amused to see die little creature in 
full chase, tight and tight after a flock of great sheep; 
when on its return it would frisk around me, and 
looking up widi innocent laughter seemed to say: "I 
did what you told me; wasn't it funny?" By and by, 
however, till I thus lost ten or twelve by its example 
in learning others to help it, had I courage to take its 
life, knowing tiiat the fault was not in the dog, but in 
myself; nor had I myself a heart, or will, to perpetrate 



( Ihristopher C 



i'n i M 1 1 ii , 



( Jraham — Dm all 



113 



the deed, but hired another to do it. This illustrates 
two vital principles: L". The force of education for 
good or evil, even upon the brute; 2' 1 . The necessity 
of punishing, or taking the life, to prevent disastrous 
consequences, and to save the lives ol many. Parents 
.mil friends often think it smart to hear their little 
ones swear or commit innocent depredations, as I did 
little Fidel, not thinking it might lead to their de- 
struction." 

His criticism of "faculty psychology" was 
particularly acute. At one time as many as 40 
"faculties" were admitted by some authors, 
and each author had a different list. Graham 
did not accept that series of errors. In a chap- 
ter titled "What is a Faculty?" he began by 
saying: 

Faculty is a word coined by the manufacturers of 
shoddy text-books on psychology, mental philosophy, 

or metaphysics — all meaning the same thing. . . . I5 

The word, he said a little later, conveys a false 
meaning and is enforced by arbitrary author- 
ity. 16 This is similar to current opinion on the 
subject. T H. Leahey, in the Encyclopedia of 
Psychology, wrote, "Strictly speaking, faculty 
psychology died in the 20th century, at least 
as regards scientific psychology. Under behav- 
iorism, psychologists became skeptical of in- 
ferred entities of any sort, including the mind, 
which therefore had no need of subdivi- 
sions." lv Graham said in the preface to his 
work, "I shall strive to drive innate ideas, as 
witches have been done, from the world, and 
to show that this thing called divine conscience 
is a parasite — an effect — is not a principle — 
has no separate existence from the prejudice 
and education of the mind. . . ." 18 His object, 
as he said, is the application of natural law to 
man, and this is certainly a scientific objective. 
He offered a one-line summary of his theory: 
"Cod has endowed us with sensibility, from 
which arise pleasure and pain, and conse- 
quently a desire or will to do or not to do! 
thus is resolved in a short sentence, the mighty 
question, the great enigma of psychology, soul, 
mind or intellect, all meaning the same 
thing." l9 

The reason Graham spent so little time and 
effort in the field of medicine was probably 
because the medical profession at the time 
was badly paid, with the exception of some of 
the large practices of fashionable cits' doctors. 
But also he was extremely skeptical about the 



benefits thai medical practitioners could con- 
fer on their patients. The medical profession 
at the time was in disarray, and theories 
abounded. Before L850 there were published 
in this country alone 213 different medical 
journals, some of them surviving only a lew- 
issues. 2 " Stricllv speaking, there was no science 
of medicine, and anyone who was interested 
primarily in science could only look on the dis- 
cipline (or lack thereof) in despair. This situ- 
ation, in some fashion or other, extended to 
many of the allied sciences, such as chemistry. 
Graham remarked: 

The chemist, though aeting upon the necessary laws 
ot science, is as often disappointed in his results from 
the endless and unseen counteracting influences, as 
the man well acquainted with human nature is of the 
anticipations of his results. The physician, in like 
manner, is constantly perplexed and disappointed in 
the sequences of his prescriptions; for though calo- 
mel be a purgative, and tarter will puke, calomel may 
vomit, and tarter purge, from some necessary exist- 
ing, yet unseen, condition of system. 21 

A little further in The true science of mind he 
made an analogy between the medic and the 
"superficial metaphysician": 

The physician, when ignorant of those occult work- 
ings upon his patient, and pressed hard for explana- 
tion, treats the ease with deep gravity and most 
learned technicality; such as morbid irritation, normal 
and abnormal condition of system; loss of sensorial 
power, accumulated excitibility, revulsion, translation, 
concatenation, and above all, "vis medieatrix natura" 
is dragged in as the universal panacea of medical ig- 
norance. 22 

He quoted at length a well-known passage 
from the French physician Francois Magendie 
(1783-1855), called by one of his own stu- 
dents "the great sceptic." Graham quoted at 
some length from one of Magendie's famous 
lectures, which begins "Gentlemen: Medicine 
is a great humbug."- 3 And this seems to mirror 
what Graham thought of the medicine of his 
day, that is, he realized it was not a science. 
Claude Bernard (1813-1878), the student of 
Magendie mentioned above, was the first to 
set medicine on the road to becoming an em- 
pirical science. Bernard wrote in his most im- 
portant book, published in Paris in 1865, "We 
are doubtless far from the time when all med- 
icine will be scientific; but that need not pre- 
vent our conceiving it possible. . . ." This may 






144 



journal nl the Kciituckv \cadeinv ol Science 65(2) 



scnf to justify Graham's doubts concerning 
the scientific nature ol medicine at the time.-' 

Graham's contributions to the progress of 
medicine, at least on the local level, wen- 
practical, and it may have been his practical 
nature that led to his more intrepid exploits in 
connection with the medical school. The post- 
mortem examination of an Irishmen, killed ln- 
one of his fellow countrymen in a quarrel, led 
to difficulties between Dr. Dudlev, the mentor 
of Graham, and Dr. Daniel Drake (1785- 
1852), die professor of medical botanv and 
materia medica. Feelings on die controversy 
ran high enough that Dudlev challenged 
Drake to a duel, something fashionable at the 
time. Drake declined die honour, but his 
friend. Dr. Richardson, professor of obstetrics, 
accepted in his place. This was dulv arranged 
with Graham as die second of Dr. Dudlev; 
Graham even cut the gold buttons off the coat 
Dudlev had bought in France, so as not to 
proxide a target. At the first exchange of fire, 
Richardson, who missed, received a potential- 
ly fatal wound, which was immediately 
stanched by Dudlev, sa\ing his life. From diis 
time the two professors became fast friends. 25 

But what of the Irishman who caused all the 
trouble in die first place? There was no sense 
in allowing him to go to waste, and this led to 
what the newspapers of die time called "The 
Battle of die Graveyard." 26 

During the period Graham was at Transyl- 
vania, the French physicians were die most 
medically advanced in die world. Pathological 
medicine was their great contribution to ^'est- 
em medical science: the concept of tracing a 
disease or illness to a specific organ or part of 
the bodv. The introduction of pathology, 
diough dien in its infancy, was (for good or 
ill), the single greatest factor changing the 
course of medical research in the United 
States. Padiological medicine logically led to 
surgery as die means of finding and removing; 
die cause of illness. Dissection, which is nec- 
essary to train a good surgeon, required a sup- 
ply of cadavers, and, in die absence of any le- 
gal means of obtaining diem, was a major 
problem for medical science. Graham wrote 
years later drat he had "'headed all die resur- 
recting expeditions." 27 He said, "I was Dud- 
ley's favourit [sic] and well I might be, and was 
his only dependence in procuring subjects, 



and was his demonstrator, often dissecting all 
night while others were out on pleasure." 2 

In 1S22. very near the time of "The Battle 
of the Graveyard," the following advertise- 
ment appeared in Wooler's British Gazette: 

Many hundred dead bodies will be dragged from 
dieir wooden coffins this winter, for the anatomical 
lectures (which have just commenced), the articula- 
tors, and for those who deal in the dead. . . . The 
violation of the sanctity of the grave is said to be 
needful, for the instruction of the medical pupil, but 
let each one about to inter a mother, husband, child, 
or friend, say shall I devote this object of my affection 
to such a purpose; if not. the onlv safe coffin is Bridg- 
man's Patent wrought-iron one. 

Da\id Burrell, in an interesting paper on 
die origins of undertaking, from which the 
preceding quotation was taken, remarks that 
Cincinnati, with sfx medical schools in die 
area, more than any other city in the West, 
was very concerned about body-snatching. He 
pointed out that the metallic coffin, intended 
to keep the body safe, may have actually aided 
the body-snatchers by keeping their quarry 
fresh longer. At any rate these intended final 
resting places were guarded bv walls and 
watchmen (the fence around the gravevard 
was never intended to keep the occupants in), 
and even with landmines, torpedoes, and 
spring guns that exploded when disturbed. As 
Burrell, who has written several papers on as- 
pects of this topic, savs: "Communities literally 
feared for their dead each time the medical 
schools began a new session." 29 

Graham said diat once his party was pur- 
sued near Nicholasville while making their 
way from a cemetery to dieir horses, and one 
of several shots lodged in the subject he was 
earning on his back. He wrote concerning die 
cause of the trouble between his professors. 

We were taking up the Irishman that caused the duel 
as above named, and again taking [taken] prisoners 
bv an armed guard and we hauled up to the court 
for trial but diere was no law to make the dead pri- 
vate property, so the declaration of the Scriptures, 
that from dust we came and unto dust we must re- 
turn let us off bv paving one cent damages for taking 
that much clay or soil. 30 

"The Battle of the Graveyard" led to what 
must have been an interesting court case. The 
defense was bv a top-notch lawyer, John Jor- 
dan Crittenden (1786-1863), who was gover- 
nor of Kentucky' from 1848 to 1850, just re- 



Christopher Columbus Gn 



mam 



Dinall 



I 15 



signed from (lie U.S. Senate in March L819 to 
return to his private practice in Frankfort, 
One writer remarked. 

In all likelihood the judicial decision not to order the 
body's return did not hinge upon any "convincing" 
quote of Genesis . . . but because the right to sue lor 
something must inhere in a preceding riulit to control 
or own. 31 

This is probably a misunderstanding of the 
situation. The lawyer and the judge were ob- 
viously aware of Blaekstone's Commentaries 
(Book 4, Chapter 17) "Of Offences Against 
Private Property," which stated that among the 
Romans die stealing of a corpse (though in- 
decent) was no felonv unless one stole some 
Of the grave clothes with it. Genesis was read- 
ily admissible into am courtroom in Kentucky 
at this time, and die passage ". . . dust thou 
art, and unto dust thou shalt return" (Gen. 3: 
19) was not irrelevant: it provided the means 
of settling the case while technically letting the 
plaintiffs win: Dust was cheap. 32 

Graham's scientific interests extended far 
beyond the field of medicine. Among the pa- 
pers of Henry Clay (1777-1852) is a letter 
from Dr. Graham written to Clay in 1825 
when Clay was Secretary of State under Pres- 
ident John Quincy Adams (1767-1848). Gra- 
ham, who had already traveled fairly exten- 
sively in the West and Mexico, told Clay he 
was interested in any kind of government mis- 
sion diat would pay him expenses for travel. 
He hoped in this manner to serve his country 
as well as further his scientific interests: 

I am fond of the sciences of Natural History and 
mineralogy, which traveling so much extends. My 
cabinet is already respectable, and I wish to enlarge 
it. M 

In 1805 the entire mineralogical collection 
at Yale University fit in a single candle box. It, 
like the somewhat larger collection at Har- 
vard, was but recently acquired. In 1810 a Eu- 
ropean collection of about 10,000 specimens 
was on loan for public exhibit at Yale. This was 
finally purchased by the college in 1825, the 
year in which Graham already had a "respect- 
able" collection. A public subscription for the 
Yale collection was made, and the purchase 
price was $20,000. Scientific collections of ma- 
terials all over the country were scanty; for ex- 
ample. Harvard's herbarium was insignificant 
until the 1840s. 34 The work of private collec- 



tors was important since the biological and 

earth sciences had nol vH completed collect- 
ing, describing, and classifying materials 

In the letter referred to above Graham re- 
minded Cla) they had met several times and 
had become acquainted a( Transylvania Uni- 
versity. (Clay was a trustee of thai institution. 
Graham also mentioned thai lie had become 
proprietor of Harrodsburg Springs, inviting 
( !lay to visit next time he was in the area. He 
discussed some political matters relating to 
Andrew Jackson, always of interest to Clay. 
Then, in the last paragraph of the letter, he 
made the following statement: 

I should be pleased to know the probability of Mr. 
Rafinesque's success in his Banking schemes, as lie 
has flooded me with letters, appointing me sole ageni 
in all his operations. I know him to be so visionary, 
that I have given the subject but little attention.* 

There is a Iikelv connection between Gra- 
ham's interest in natural history and his ac- 
quaintance with Constantine S. Rafinesque 
(1783-1840). It may have been Grahams 
practical business instincts diat led Rafinesque 
to fix upon him as suitable to advance his 
scheme of divisible stock coupons. Graham's 
consideration of Rafinesque is in keeping with 
the general opinion of him at the time. Raf- 
inesque related that he visited Graham in the 
course of his travels in Kentucky: 

I visited again the small cabinet of Mai. Thompson 
at Shawnee Spring near Harrodsburg. that of Shells 
of Dr. Graham at Harrodsburg, and that of curiosities 
by Mrs. McDowell at Danville. I went on horseback 
with Dr. Graham to survey ancient monuments on 
Salt R. where we dug fossil teeth. 37 

Dr. Graham was a life-long naturalist. We 
have some of his descriptions of geological for- 
mations, one of which is the "Devil's Pulpit' 
along the Kentucky River in Nelson Countv 
Frederick Hall, M.D. (1780-1843), who visit- 
ed Graham's Springs in June 1837, wrote. 

I cannot help saving, that our polite landlord i^ ad 
mirably qualified for the management of this im- 
mense establishment. Doctor Graham is a well-in- 
formed physician, gentlemanly in his deportment, 
and exceedingly accommodating to all his boarders. 
His many kind attentions have brought me under 
lasting obligations to him. We have taken several long 
walks together. To-day he made me acquainted with 
an interestini: localih ol the sulphate of barvtes. It is 
about two miles south from his house. The substance 



14fi 



Joiinml of (lie Kentucky Acadeim ol S 



cienc( 



65(2) 



forms a vein, in secondary limestone rock, which is 
nearly perpendicular to the horizon, varying in thick- 
ness from one to eight inches, and extending, ac- 
cording to Dr. G. at least, twenty miles in length. The 
mineral is white, and its structure laminated. 1 ' 1 

Graham explored caves and was an invet- 
erate collector of fossils and other natural ar- 
tifacts; in 1872 the large cabinet he collected 
was estimated to be worth $250,000. His ma- 
terial was donated to the Museum of the Ken- 
tucky Free Public Library (Louisville) at that 
time, and he began to assemble another col- 
lection. In his archaeological work at Big Bone 
Lick, Graham was not content merely to col- 
lect bones, but he formed a theory concerning 
die geology of the region, which I will not cov- 
er here; he described the valley and explained 
why it was sinking. Graham did not merely 
collect, like Prof. Rafinesque, but he also 
wrote accounts in which he attempted to set 
forth the significance of what he had found. 

Dr. Graham had been a close observer of 
wildlife from an early age. He once compared 
himself to John James Audubon (1785-1851), 
the famous naturalist and painter of birds, 
with no advantage to the latter: 

Audubon was never a closer observer of birds than I 
have been of all animals; so much so, indeed, that I 
have learned the language of many of them. I can 
tell by the voice of birds when they see a serpent as 
well as if I were to see it myself." 10 

In the early part of the 19th century the 
biological and earth sciences were still in die 
process of collecting, describing, and classify- 
ing materials. Rafinesque, often exuberant and 
careless in his methods, was among the first 
scientists of note in the West to engage in this 
necessary task on such a large scale. His meth- 
ods and manner left him open to criticism, so 
diat he did not always get credit for what he 
actually accomplished, but part of his legacy 
in the West — Kentucky at diat time — was his 
students. He is said to have been the first (if 
not the first, one of the early few) to actually 
use specimens in the classroom. He was an 
indefatigable traveler, collector, and writer. He 
attempted to found a botanical garden in Lex- 
ington, but the project came to naught. A pro- 
fessor of Rafinesque s caliber would have left 
a profound mark on a student such as Gra- 
ham. Even if Graham never sat in his formal 
lectures (though it is likely that he did), Tran- 



sylvania University was too small for such an 
influence to be unfelt. Graham, with his in- 
terest in nature and science, whatever reser- 
vations he might have had about Rafinesque's 
"visionary" tendencies, would have gravitated 
to a teacher with such a background and 
knowledge." 

Graham's work in geology and archaeology 
may have been his most visible contribution to 
scientific work in Kentucky. In 1871 the Public 
Library of Kentucky was incorporated by the 
Legislature. Former Gov. Thomas Bramlette 
(1817-1875), Graham's son-in-law, and Reu- 
ben T. Durrett (1824-1913), of the Kentucky 
Historical Society, who also married one of 
Graham's daughters, were the chief organiz- 
ers. They raised over $400,000 (by means of a 
lottery, though the word "lottery" was carefully 
avoided) to endow it. The next year a building 
for the library was purchased for $210,000. 
There were placed in it 40,000 volumes, and 
a Museum collection of 250,000 "specimens." 
Graham was named curator of die museum 
and was the chief donor of the artifacts. It was 
in this capacity that he conducted the exca- 
vations at Big Bone Lick. The Library itself 
soon went bankrupt, amid charges of fraud 
and mismanagement. 4 - Its effects went to die 
Polytechnic Society of Kentucky, and later to 
the Louisville Free Public Library. It may not 
be possible to even trace die materials at this 
point, since the Louisville Free Public Library 
later gave away all the artifacts to museums 
across the country, apparently without docu- 
menting where anything went. 43 As late as 
1884 Graham still had materials to sell and 
donate, as he wrote to John P. Knox (1844— 
1903), the state geologist. 44 

Elsewhere I have published Grahams ac- 
count of his excavation at Big Bone Lick, 
Boone County, Kentucky; only a brief sum- 
mary is given here. 45 For 30 days he dug with 
10 men from the area who were paid one dol- 
lar a day. Graham was then 93 years old. He 
wrote not only about his own excavation but 
also provided a glimpse of prior digs in the 
area. He was fortunate to have as one of his 
workmen Thomas Rich (1808-1883), who had 
dug there on various excavations for years. Na- 
thaniel S. Shaler (1841-1906), mentioned 
here, was professor of geology at Harvard Uni- 
versity. He excavated at Big Bone Lick in 
1863. Graham said in the article: 



Christopher Columbus Graham — Dm/ill 



i r 



In the year 1833 Thomas Rich, as above named, 
who dug for me. was foreman in excavating lor- an 
agent of New York, and exhumed a gigantic skeleton, 
twenty-two feet long and eleven feet high, with disks 
twelve feet long, all ol which are now in the Kentucky 
Department of the British Museum, in London. Mr. 
Rich told me that he also disinterred, during the 
same digging, the skeleton of an elk whose horns 
were seven feet long, since which he has been dig- 
ging for various parties, among whom was Mr. Shaler. 
our present geologist of Kentucky, but never found 
an entire skeleton ol any kind; and I to save money 
to those who may wish to search, say that I am sat- 
isfied there will never be another found. I obtained 
petrified horns ol both deer and elk, but not very 
large. 

There are several important things about Gra- 
ham's investigation. The most significant 
seems to be the following discovery, which he 
owed to Mr. Rich and the local workers: 

In my excavations we often came to piles of what 1 
drought were collections of yellow, soft sand; but see- 
ing die old diggers rubbing it between their hands 
till warm, and smelling it with a grin and leer of the 
eye diat said to me you are green, I found it to be 
decayed flesh that still had the odor, as dogs around 
the pit would smell and scratch into it. 

I am not aware that any other excavator 
mentions die preserved remains of the flesh 
oi these creatures. If this is true, and I see no 
reason to doubt that it is, it would certainly be 
relevant in any inquiry concerning the age of 
the beasts whose bones have created so much 
interest. If conditions have continued to pre- 
serve this flesh in a state similar to the present, 
it might even be possible for archaeologists to 
acquire DNA samples from it, which would 
doubtless extend our knowledge on the whole 
subject of the animals inhabiting the Lick in 
prehistoric times. 

One of Graham's other discoveries of more 
local historical interest at Big Bone Lick is his 
finding the remains of the salt-boiling works, 
which ceased about 1812. He found them six 
feet below the surface, and he offered an ex- 
planation as to why the ground should be lit- 
tered with preserved bones (that is, hard and 
undecayed) when the Lick was discovered, but 
the bone-bed should be so far below the sur- 
face, 10 to 12 feet, in 1876. So far as finding 
artifacts is concerned, the excavation could 
probably be called a success, as Graham re- 
ported that he "brought off seven barrels of 



bniics. a number ol buffalo heads, and both 

mammoth and mastodon molars but found no 
very large bones or tusks 'bill had nine feet of 
a 14-foot tusk given me b) Mr, McLaughlin 
proprietor [of the hotel]), and left upon the 
ground a earl load of bones of various ani- 
mals." 46 Bid it was significant in other ways, 
and it speaks well lor Graham as a scientist 
that he was concerned (o publish an account 
ol his findings rather than nierch earn awav 
bones, as was the habit of so many of the oth- 
ers who sought bones at the Lick. 

Dr. Graham was in communication with a 
number of eminent scientists. He wrote his 
account of the excavations at Big Bone Lick at 
the request of Prof. Fredric W. Putnam 
(1839-1915) of Harvard University. Professor 
Putnam became curator of the Peabodv Mu- 
seum of American Archaeology there in 1875. 
a year prior to the work at Big Bone; he held 
the position until 1909. Appointed professor 
of archaeology and ethnology' at Harvard in 
] SS6, he is considered one of the first anthro- 
pologists to work in the United States. In 1874 
he served as the assistant to the Kentucky 
Geological Survey under Dr. Shaler, and it was 
likely that he met Dr. Graham at this time. 

Graham also corresponded with Charles 
Darwin (1809-1882). In a four-page letter dat- 
ed 30 Jan 1877, he informed Darwin that he 
had defended him, John Tyndall (1820-1893), 
and others against the attacks of a clergyman. 47 
It seems Graham also sent him a copy of the 
article on Big Bone Lick, which had been pub- 
lished in the Courier-Journal (Louisville) on 
29 Jan 1877, and this was probably the real 
reason for the letter. Darwin is said to have 
commented favourablv on the article and to 
have passed it on to Thomas Henry Huxlev 
(1825-1895) and others, who made similar 
comments on it. There are two short letters 
Graham wrote in 1880 (28 March and 17 
April) in which he informed Darwin that his 
earlier letter had been framed and was to be 
placed in the Kentucky statehouse. No doubt 
this was to be in the fireproof rooms that hail 
been given the Kentucky Historical Society, ot 
which Graham was a charter member. 

In 1S20 Graham married Theressa Sutton, 
daughter of the proprietor oi the Harrodsburg 
Springs, and soon owned the resort himself. 
Here is how Frederick Hall, himself a medical 
doctor, described it: 



148 



Journal <>l the Kentuck) Acaderm ol Science 65(2) 



Our stage drove directly to the hotel <il Doctor Gra- 
ham, the proprietor "I one of the springs, and ol lln- 
principal public house in the village. I soon betook 
myself to the healing fountain. Its waters, I found, 

contain sulphuretted hydrogen, carbonic acid — much 
less abundant, however, than at the Congress, or 
Round Rock Spring, ol Saratoga — together with the 
sulphates of soda, lime and magnesia. They send 
forth a disagreeable odor, and yet the water is not 
offensive to the taste. I drank two tumblers of it with 
a good gout. Its effect is cathartic. It operates speed- 
ily on die bowels, and produces a cleansing, salutary 
result. There are other springs in the neighborhood, 
comprising different ingredients, and producing dif- 
ferent effects, and which are known by the appella- 
tions of Salt Spring, Chalybeate Spring, and Vitriol 
Spring. — They do things here on a broad scale. The 
Spring-house, and hotel, in which I am lodged, is 
sufficiendy capacious to accommodate seven hundred 
boarders, and it is, Doctor G. assures me, filled dur- 
ing the watering season, to overflowing. It covers 
more ground, he remarks, than any other public 
house in die United States. 48 

In the next year or so the hotel was expanded 
to accommodate 1000 people. 

Marriage and settling into a medical prac- 
tice did not end Dr. Graham's adventures. In 
1822 he was in Mexico City with one of his 
schoolmates from Transylvania, Stephen A. 
Austin (1793-1836), who was die cousin of 
Mrs. Mary Austin Holley (1784—1846), wife of 
the president of the university. There he met 
Gen. James Wilkinson (1757-1825), famous in 
Kentucky for his part in the Burr Conspiracy. 49 
Graham is supposed to have smuggled out of 
the city, in a pair of worn out old shoes, die 
constitution Wilkinson wrote for die new gov- 
ernment of Mexico. In 1826 Graham bought 
the Greenville Springs near Harrodsburg, 
though he did not operate it as a resort; he 
gave part of the land to found two educational 
establishments. A letter published in the Ken- 
tucky Reporter (Lexington) from General An- 
drew Jackson reported that the General, not 
quite at die height of his fame, was contem- 
plating visiting Harrodsburg Springs on ac- 
count of his wife's health but changed his 
mind when she recovered. 50 

In 1832 Graham bought a lead interest at 
Galena, Illinois. There he made acquaintance 
with another fellow Kentuckian and alumnus 
of Transylvania, Lt. Jefferson Davis (1808- 
1889), just before the Black Hawk War be- 
gan. 51 After the war was over in spring 1833 



he returned Black I lawk and his Famil) to 
their home in Iowa aboard his steamboat. 52 

In the years following, Graham was ab- 
sorbed in developing Harrodsburg Springs 
and improving the roads in the area, which 
helped his business. He is said to have fi- 
nanced many improvements to the public 
roads himself. Graham claimed to have put 
$300,000 into the resort at Harrodsburg 
Springs, which by then was often referred to 
as Graham's Springs. In 1853 he sold the re- 
sort and die 203 acres on which it stood. It 
was bought for $100,000, for use as a military 
asylum by the United States government. 

Graham and his oldest son, Montrose, were 
on die Survey of the Southern Atlantic and 
Pacific Railroad, under Col. Gray in 1852. 
Such surveys were important in the develop- 
ment of science in this country. 53 Graham 
served as the surgeon on this expedition. 
There were a number of incidents, as when 
the party was captured by die Apaches and 
ransomed. Graham soon found himself at odds 
with Gray and broke off for his own trip into 
Mexico. He was looking for a geological for- 
mation of which he had heard, avast mountain 
of iron worth a fortune, though never found. 
Mexico was in a civil war, and Graham's party 
barely escaped widi dieir lives. When they got 
to die Pacific they took a boat for San Fran- 
cisco, but it was unseaworthy, and they were 
at sea for 69 days with little food or water. 

A year later Graham purchased Sublimity 
Springs and 1500 acres on die Rockcastle Riv- 
er for $20,000. He built a hotel and a flour- 
and-saw mill and greatly improved the prop- 
erty, but the days of die watering-places had 
reached their zenith, and Sublimity never at- 
tained the stature of Harrodsburg Springs, 
which burnt a few years later. In 1858 die 
Springs was operated for Graham by Camp- 
bell and Kromp. Lodging was $5 per week, 
and $3 a week for horses. He published a book 
in New York in 1859 titled Man from his cra- 
dle to his grave. It was a 451 -page work on 
psychological subjects, but I have not been 
able to get access to it. In the same year his 
wife, Theressa, died. 

Graham devoted much of his time in this 
period to writing. In 1861, when he was 76, 
Graham married Miss Columbia Buford, age 
22, and moved to Crab Orchard, Kentucky. 
She died in 1864, in his 80di year, soon after 



Christopher Columbus Graham -Duvall 



I 19 



the birth of their son, the seventh of liis chil- 
dren, and the <>nlv one to follow their father 
into tlit- medical profession. In ISo2 Craham 
was illegally arrested by Union soldiers, one of 
whom he severely wounded, as a Confederate 
sympathizer. He was imprisoned for a week 
and then released, lie published The true sci- 
ence of medicine in 1866 and The true philos- 
ophy of mind in L869. 54 The next year began 
his association with the Public Library of Ken- 
tucky. Richard II. Collins (182^1889) pub- 
lished the two-volume History of Kentucky in 
1874 and acknowledged the contributions of 
Dr. Graham to his research. From this point 
until his death in 1885 Graham became more 
and more involved in the history of Kentucky, 
writing letters to people such as Lyman C. 
Diaper (1815-1891), one of the foremost col- 
lectors of manuscripts and other materials for 
the history of the West. 55 In addition Graham 
wrote a series of articles about the early pio- 
neers of Kentucky, which appeared in die 
Louisville Monthly Magazine (1879). 

In 1880 Graham became a charter member 
of die Kentucky Historical Society; indeed, it 
is probably significant that his name is the first 
on die list in the charter granted by the state 
legislature. When he was 90 he still went on 
frequent expeditions for geological specimens, 
which would have included the excavation at 
Big Bone Lick. Col. E. C. Walton, the 50-year 
editor of the Stanford Interior Journal, re- 
membered that Graham, at age 97, walked the 
10 miles from Crab Orchard to Stanford to eat 
a birthday breakfast with a friend. 56 For his 
100th birthday his friends in Louisville held a 
centennial celebration at the Louisville Hotel, 
consisting of a huge pioneer dinner and many, 
many toasts, all of which was written up and 
occupied most of the front page of the Cou- 
rier-Journal along with a wood-cut showing 
Graham as a venerable-looking gentleman 
with long white flowing hair. This event was 
felt by many of those present, and his acquain- 
tance, to be the passing of an age, since he 
was the last living link with the early past of 
Kentucky, and he had been acquainted with 
most of the pioneers of note. 57 

Upon the grounds of the Harrodsburg 
Springs — the sole remaining relic of the era 
when the resort flourished under Dr. Gra- 
ham — is a tombstone marked "Unknown." It 
is not the stone of Craham. At Ins death on 3 



Feb L885 he was buried in the cemeter) in 
Danville, nol far from the place of the pioneer 
fort in which he was born on 10 Ocl 1784. Il 
is perhaps fitting that the stone of one who 
began his scientific career robbing graves 
should have been stolen. ' The stone on the 
grounds at the Springs marks the grave oi a 
society girl of the south who \ isited and. after 
dancing all night in the fashionable ballroom, 

fell (lead in the morning. ' This romantic in- 
cident seized the public imagination, and 
passed into Kentucky legend, forever to be as- 
sociated with Graham's Springs. It max serve 
to remind us that there are many things we 
would like to know about Craham and the 
people of this era, but also there is much we 
owe them. 61 The past, though vanished, still 
lives in the collective memory through the 
writing and reading of history and offers us 
insight into the present. 

ENDNOTES 

1. Thomas D. Clark. Tlic Kentucky (1942: rpt. Lexing- 
ton: University Press of Kentucky, 1992), p. 223. A 
$10,000 was reward offered and advertised in Europe 
and America to anyone who could out-shoot Graham. 

2. G. Glenn Clift, Notes on Kentucky veterans of the 
War of 1812. (Anchorage, Kentucky: Borderland 
Books, 1964). p. 342. 

3. Kentucky Soldiers of The War of 1812. Report of the 
Adjutant General of the State of Kentucky. (Frank- 
fort: E. Polk Johnson. 1891). He is reported to have 
served from 1 Jan 1814 till 31 Oct 1814. There is 
some indication diat this was his second period of 
sendee in that war. 

4. John D. Wright, Transylvania, Tutor To the West 
(Lexington: Transylvania University, 1975; qit. Uni- 
versity Press of Kentucky, 1980), p. 84. 

5. Russel Blaine Nye, Society and Culture in America. 
1830-1860. (New York: Harper & Row. 1974 1. p. .342 
remarks that in this period nearly all physicians were 
general practioners. and the income was not high. As 
late as 1873 there were hut 149 hospitals in the entire 
country, and a country doctor might make $3000 a 
year. 

6. Extensive searches have been made for this work. 1 
would like to thank my colleagues Jinny Ussel and 
Michelle Foster, of the Boone Count) Public Library, 
Union, Kentucky, for doing an exhaustive internet 
search lor this hook, ami Maggie lleran ol the Lloyd 
Library, Cincinnati, lor searching their collection ot 
medical tests for the same vllsheler unite ol this 
book in 1933: "En<iuir\ was made in a number el 
libraries, including the larger libraries in Louisville 
and the Librarv of Congress, hut no copy was located. 



15(1 



Journal of the Kentucky Academy of Science 65 2 



The Filson Club wilt be glad to have its attention 
called to the whereabouts of any copy." p. 87, n. 19. 

7. This is reported in the letters published by Prof. Ha- 
nion cited below. 

8. See Clark. "Graham's Springs.'' The Kentucky, Chapt. 
14. p. 220-237. and C. A. VanArsdall. "A Medical His- 
tory of the Harrodsburg Springs." Bulletin of the His- 
tory of Medicine, Vol 23. No. 4 (1949): 387^18. 

9. L. J. Frazee. M.D. "The Mineral Waters of Ky." A 
Paper Read before the Kentucky State Medical So- 
ciety April 1872: rpt. from lTtli Vol., Transactions of 
the Kentucky State Medical Society. (Louisville: Hart 
& Mapother, 1872), p. 6; Kentuckiana Digital Library, 
KY\"L. Aperient means slightly laxative, and by exten- 
sion, causing appetite. 

10. This is probably die person listed as Bernard Thomas, 
age 30, along with his wife, in the Graham household, 
along with many other families who were staying at 
the hotel, in the 1850 census. He was born in Maine, 
and his occupation is listed as a physician. 

11. VanArsdall, p. 404. 411. The book which caught Dr. 
Graham's attention is Roland S. Houghton, ed., Bul- 
wer, Forbes, and Houghton on the Water-Treatment: 
A Compilation of Papers on the Subject of Hygiene 
and Rational Hydropathy (New York: Fowlers and 
Wells, 1854). 

12. Ibid., p. 413. 

13. Christopher Columbus Graham, The True Philosophy 
of Mind. (Louisville: J. P. Morton and Co., 1869), p. 
61. Graham's book is full of references to Paley and 
other theologians. Nye, p. 237, remarks that Paley's 
Xatural Theology (1802) was "such standard reading 
for educated Americans diat references to him need 
never be explained." 

14. Ibid., p. 91. Breachy means "apt to break fences or 
to break out of pasture." 

15. Ibid., p. 14.8-153. 

16. Ibid., p. 149. 

17. T. H. Lealiev, "Faculty Psychology," in Encyclopedia 
of Psychology, ed. 2, R. ]. Corsini. editor. (New York: 
Wiley, 1994): II, 6-7. 

18. True Philosophy of Mind, p. 11. 

19. Ibid., p. 12. 

20. Nye, p. 355. 

21. True Philosophy of Mind, p. 28. 

22. Ibid, p. 40. 

23. Magendie, who was President of the French Academy 
of Science, wrote: 

Let us no longer wonder at die lamentable want of 
success which marks our practise, when there is 
scarcely a sound physiological principle among us. I 
hesitate not to declare, no matter how sorely I should 
wound our vanity, diat so gross is our ignorance of 
the real nature of the physiological disorder called dis- 
ease, that it would perhaps be better to do nothing, 
and resign the complaint into the hands of Nature, 
dian to act as we are frequendy compelled to do, 
widiout knowing tie why and wherefore of our con- 



duct, at the obvious risk ol hastening the end of the 
patient. 

Gentlemen, medicine is a great humbug I know it 
is called a science. Science indeed' II is nothing like 
science. Doctors are mereK empirics when they are 
not charlatans. We are as ignorant as men can be. 
Who knows anything in the world about medicine? 
Gentlemen, you have done me a great honor to come 
here to attend my lectures, and I must tell you frankh 
now. in the beginning, that I know nothing in the 
world about medicine, and I don't know anybody who 
does know amthing about it . . . I repeat, nobody 
knows anything about medicine. . . . 

We are collecting facts in the right spirit, and I dare 
say, in a century or so, the accumulation of facts may 
enable our successors to form a medical science. Who 
can tell me how to cure the headache, or the gout, or 
disease of the heart? Nobody. Oh, you tell me the 
doctors cure people. I grant you people are cured, 
but how are they cured? 

Gendemen. Nature does a great deal, imagination 
a great deal; doctors — devilishly little when thev don't 
do any harm. 

24. Claude Bernard, An Introduction to the Study of Ex- 
perimental Medicine (London: Maemillan, 1927; re- 
print New York: Dover, 1957), p. 214. 

25. Christopher Columbus Graham, Two Letters Con- 
cerning the Early History (1817-1818) of the Medical 
College of Transylvania University Lexington, Ken- 
tucky, ed. ]. Hill Hamon. (Frankfort: Whippoorwill 
Press, 1993). I would like to diank Prof. Hamon for 
sending me a beautifully hand-printed and bound 
copy of his book. See also Robert Peter, M.D., His- 
tory of the Medical Department of Transylvania Uni- 
versity. Filson Club Publications No. 20 (Louisville: 
John P. Morton, 1905), 24-25. Kentuckiana Digital 
Library. 

26. Letters, ed. Hamon: excerpt in Peters, p. 33, note. 

27. 2 Feb 1876 in Ibid., ed. Hamon p. 13-15. Note that 
Rafinesque, probably the best scientist on the faculty, 
never became a medical doctor because he had an 
aversion to dissection. For some historical context of 
Rafinesque and Transylvania in the medical botany 
movement, see Michael Flannerv. "Medical Botany in 
Kentucky 1792-1910," Transactions of the Kentucky- 
Academy of Science 60 (Spring 1999):21-23. 

28. 12 Feb 1876 in Ibid., p. 20. 

29. David Burrell, "Origins of Undertaking: How Ante- 
bellum Merchants made Death their Business," 9 Jun 
1988. Internet. 

30. Letters, ed. Hamon, p. 13-15. 

31. David Burrell. "From Sanctity to Property: Dead 
Bodies in American Society and Law, 1S00-1S60," 
1997. Internet. He cites this case from Margaret M. 
Coffin, Death in Early America: the History and Folk- 
lore of Customs and Superstitions of Early Medicine, 
Funerals, Burials and Mourning (1976). Coffin is mis- 
taken in saving diev had to pav a dollar in damages. 



Christopher Columbus Graham — Dttrall 



since Graham s;i\s the fine was one cent. One cent 
would be more in keeping wiili the money pour stu 
clenis would have available For such ;i purpose, and 
with the intention ol the judge in awarding the dam- 
ages. 

32. Il is interesting to nolo in this respect thai in the 
South sometimes the bodies of slaves were made 
available tor aiialoinie.il study— with the approval of 
the master In ls.it, according to the Kentucky House 
Journal (1833—1844), p. 104. there was a bill "to au- 
thorize and require the judge oi the different Circuit 
Courts to adjudge and award the corpses of Negroes, 
executed by sentences of said judges, to the Faculties 
of the different chartered Colleges of the state, for 
dissection and experiment." It was rejected by the 
House of Representatives 41-34. (Wright. Transyl- 
vania, p. 8.5.) There is also a case which may serve to 
show how anxious students were for cadavers. In 1858 
a Kentucky slave, soon to be hanged for murder, sold 
his body to two medical students for ten cents worth 
of candy. The state, which had paid $900 for the slave, 
presumably did not object. (Prof. A. M. Yealey, "The 
Story of Joe, a Slave Boy: A Story of Murder and Near 
Mob Violence," The Northern Kentucky Sews. 8 Oct 
1954. p. 2). 

33. Christopher Columbus Graham to Henry Clay (31 
Aug 182.5). The Papers of Henry Clay, ed. J. F. Hop- 
kins, Vol. 4, p. 608. 

34. George H. Daniels, Science in American Society: A 
Social History (New York: Knopf. 1971), p. 130-131. 

35. Nye, p. 252. 

36. Graham to Clay (31 Aug 1825). The Papers of Henry 
Clay. Vol. 4, p. 609. For a length)- discussion of Raf- 
inesque's incursion into the world of banking, see Le- 
onard Warren, Constantine Samuel Rafinesque: A 
Voice in the American Wilderness (Lexington: Uni- 
versity Press of Kentucky, 2004), "The World of Fi- 
nance and Banking." p. 100-108. Warren concludes 
that by the time he left Kentucky, Rafinesque "suf- 
fered serious mental derangement." (p. 108) 

37. Constantine S. Rafinesque. A Life of Travels and Re- 
searches in North America and South Europe, or. 
Outlines of the Life, Travels and Researches of C. S. 
Rafinesque: Containing his travels in North America 
and the south of Europe. . . . ire, from 1802 to 1835 — 
with sketches of his scientific and historical research- 
es, be. (Philadelphia: Printed for the Author, 1836), 
p. 74. Mrs. McDowell was the widow of Dr. Ephraim 
McDowell (1771-1830), a famous Kentucky surgeon. 
He was noted for his success in lithotomy, and in 1809 
he performed the first ovariotomy. 

38. Lewis Collins. Collins' Historical Sketches of Ken- 
tucky. (Frankfort: Kentucky Historical Society-. 1966). 

39. Frederick, Hall. Letters from the East and from the 
West (Baltimore: F. Lucas, Jr.. 1840). p. 137. Ameri- 
can Memory Project. 

40. Philosophy of Mind, p. 215. 

41. For more on Rafinesque, see John W Thieret and 



David M Brandenburg, "Rafinesque and l 
diana, Vol. 6, No I 2001 I 9 This ma) I" u 
cessed at. http://wwu geocities.com/kentuckijhist/ 
rafine-thieret.html/ 

42. R. C. Riebel. Louisville Panorama: A Visual History 
of Louisville, i Louisville: Libert) Nation. il Bank and 
Trust Company, 1954), p. 172. Of the $5,900,000 
raised, the libraiy received onl) S 150,000. Where the 
rest ol the money wenl is still a mystery. 

43. I have not been able to unravel everything relating to 
the material placed in the Museum. The information 
relating to the disposition of the archaeological col- 
li' Hon was given me b) Joe Hardesty, ol the Louis- 
ville Free Public Library. I would like to thank him 
in addition for providing me with copies of several 
valuable articles relating to Graham. 

44. Knox followed Shaler as state- geologist in 1880 
though he bad no geological training. He was fired In 
Cov. John Y. Brown I for not hiring the governors son 
on the geological survey but was offered a position in 
Washington, D.C. soon after. 

45. Jillson apparently was not aware of this excavation 
but otherwise provides the best summary of the digs 
in the 1800s. See Willard Rouse Jillson. Big Bone 
Lick: An Outline of Its History, Geology And Pale- 
ontology. (Louisville: The Standard Print. Co.. 1936). 

46. Christopher Columbus Graham. "The Mammoth's 
Graveyard," Courier-Journal. 29 Jan 1877. p. 1. This 
was reprinted other places, including the Boone 
County Recorder, 22 Feb 1877. p. 1. This ma) be 
accessed at: http://geocities.com/bigbonehistory/ 
graham-excavation, html/ 

47. Cambridge University Library Darwin Project. The 
citation for these letters is: DAR 165:83-84. I have 
not been able to secure copies of these letters due to 
die prohibitive cost of getting them copied. 

4S. Letters from the East and from the West. p. 136. Gout 
means "taste, flavour, relish." 

49. See Christopher Columbus Graham. Pioneer Life: A 
Sketch of the Life and Services of Bland Ballard. 
Some Secrets of the Burr Conspiracy" Louisville 
Monthly Magazine Vol. 1. No. 1 (Jan 1879): 10-14: 
see also Allen's History. 

50. Jackson to Thomas P. Moore. Letter published 2 Oct 
I S26 and cited in Clai/ Papers. 609. 

51. Letter of Pres. Jefferson Davis to Graham Centennial 
Committee, 4 Oct 1SS4. Printed in Prof. A. M. Stick- 
les, "The Christopher Columbus Graham Dinner." 
Courier-Journal. 1 Jun 193.5. 

52. Philosophy of Mind. p. 191-192. This has not been 
independently confirmed, but it is assumed Graham 
would not have made such a claim as there were still 
a number ol people alive, including Jefferson Davis, 
who could have contradicted it il it were not so. Black 
Hawk wrote an autobiography and states the) were 
returned home in a steamboat. Graham is not men- 
tioned, but the dates fit. 



152 



Journal of the Kentucky Academy of Science fi.5(2) 



53. Allen, p. 314. Daniels, p. 181. discusses the impor- 
tance of the Railway Surveys for American Science. 

54. The title printed on die spine of the original binding 
is "The True Science of Mind." 

55. The catalogue of the Draper Collection lists a number 
of letters from Graham. Calendar of the Kentucky Pa- 
piTs of the Draper Collection of Manuscripts, ed. M. 
C. Weaks, (Madison: State Historical Society of Wis- 
consin, 1925; rpt. 1979). 

56. VV. O. Mclntyre, "Memories of Dr. Christopher Co- 
lumbus Graham," Courier-Journal, 27 Dec 1931. 

57. Reuben T Durrett, The Centenary of Louisville. 
(Louisville: John P. Morton, 1893). Kentuckiana Dig- 
ital Library. 

58. httpJ/newsarch. rootsweb.com/th/read/KYMERCER/ 
2003-08/1060810882 

59. The unknown belle was Mollie Black, Tazewell, Ten- 
nessee. Corinne Roosevelt Robinson, a minor poet 
and sister of the President, visited the locale and 
wrote a poem about the incident. An interesting his- 
torical account of this tragedy is in Clark, The Ken- 
tucky, p. 220-222. 

60. Another interesting memorial to Graham which has 
survived is on the Lincoln memorial in Springfield, 
Illinois. His image is engraved on the Kentucky panel 
of the monument. He was present at the marriage 
of Lincoln's parents and (according to reports) vis- 
ited the family often. His last act was to dictate a 
letter to Lincoln's son Robert, then Secretary of 
War. For further information see: http://www. 
nps.gov/libo/sculptured-panels3.htm/ and http-.llwww. 
ehistory.com/uscw/library/books/lincoln006.cfm/. 
An early biographical account of Graham I neglected 
to mention above is: The Biographical Encyclopedia 
of Kentucky (Cincinnati: Armstrong and Company, 
1878), p. 439. 

LITERATURE CITED 

Allen, W. B. 1872. A history of Kentucky: embracing 
gleanings, reminiscences, antiquities, natural curiosities, 
statistics, and biographical sketches of pioneers, sol- 
diers, jurists, lawyers, statesmen, divines, mechanics, 
farmers, merchants, and other leading men, of all oc- 
cupations and pursuits. Louisville: Bradley & Gilbert, 
reprint 1967. 

Altsheler, B. 1933. C. C. Graham, M.D., 1784-1885: his- 
torian, antiquarian, rifle expert, centenarian. Filson 
Club History Quarterly, Vol. 7, No. 2:67-87. 

Bernard, C. 1927. An introduction to die study of exper- 
imental medicine. Translated by H. C. Green. London: 
Macmillan, reprint New York, Dover, 1957. 

Burrell, D. 1997. From sanctity to property: dead bodies 
in American society and law, 1800-1860. http://dave. 
burrell.net/bodyasproperty.html 

Burrell, D. 1988. Origins of undertaking: how antebellum 
merchants made death their business. 9 Jun 1988. 
http://dave.burrell.net/OofUnder.html 

Calendar of the Kentucky Papers of the Draper Collection 



of Manuscripts. L925. ed M. C. Weaks. Madison: Stale 

Historical Society of Wisconsin, reprint 1979. 

Clark, T. D. 1942. Graham's Springs, in The Kentucky. 
report Lexington: University Press of Kentucky, 1992. 
Chapt. 14, p. 220-237. 

Clift, G. G 1964. Notes on Kentucky veterans of the Wai 
of 1812. Anchorage, Kentucky: Borderland Books. 

Collins, L. 1966. Collins' historical sketches of Kentucky: 
history of Kentucky. Franklort: Kentucky Historical So- 
ciety. 

Daniels, G. H. 1971. Science in American society: a social 
history, New York: Knopf. 

Davis, Pres. J. 1935. to Graham Centennial Committee, 4 
Oct 1884. Printed in Stickles, The Christopher Colum- 
bus Graham dinner (Courier-Journal, 1 Jun 1935). 

Dictionary of American biography. 1957-1964. New York: 
Scribner. 

Durrett, R. T. 1893. The centenary of Louisville. Louis- 
ville: John P. Morton. Kentuckiana Digital Library. 

Encyclopedia of Louisville. 2000. Lexington: University 
Press of Kentucky. 

Frazee, L. J., M.D. 1872. The mineral waters of Ky. (A 
paper read before the Kentucky State Medical Society 
April 1872; reprint from Vol. 17, Transactions of die 
Kentucky State Medical Society.) Louisville, KY.: Hart 
& Mapother Kentuckiana Digital Library. 

Flannery, M. A. 1999. For a voluptuous glow of health 
and vigor: medical botany in Kentucky, 1792-1910, 
Transactions of the Kentucky Academy of Science 60 
(Spring 1999):15-30. 

Graham, C. C. 1877. The Mammoth's graveyard, Courier- 
Journal. 29 Jan 1877, p. 1. This was reprinted several 
other places, including the Boone County Recorder, 
22 Feb 1877, p. 1. http://geocities.com/bigbonehistory/ 
graham-excavation.html 

Graham, C. C. 1869. The true philosophy of mind. Lou- 
isville: J. P. Morton and Co. 

Graham, C. C. 1879. Pioneer life: a sketch of the life and 
services of Bland Ballard. Some secrets of the Burr con- 
spiracy, Louisville Monthly Magazine Vol. 1, No. 1:10- 
14. 

Graham, C. C. 1993. Two letters concerning the early his- 
tory (1817-1818) of die medical college of Transylvania 
University Lexington, Kentucky, ed J. Hill Hamon. 
Frankfort: Whippoorwill Press. 

Graham, C. C. 1825. to Henry Clay (31 Aug 1825) in The 
papers of Henry Clay, ed J. F. Hopkins, Vol. 4, p. 608- 
609. 

Hall, F. 1840. Letters from the East and from the West. 
Baltimore: F. Lucas. Jr. 

Hogeland, Col. A. 1884. Ten years among the newsboys, 
ed. 5. Louisville: John P. Morton. Kentuckiana Digital 
Library. 

Jillson, W. R. 1936. Big Bone Lick: an oudine of its history, 
geology and paleontology. Louisville: The Standard 
Printing Co. 

Kentucky soldiers of The War of 1812. 1891. (Report of 



( Ihristopher Columbus Graham — Duvall 



L53 



the adjutant general of the State of Kentucky.) Frank- 
fort: E. Polk Johnson. 

Leahey, T. II. 1994. Faculty psychology, in Encyclopedia 
of psychology, ed. 2, R. J. Corsini, editor. New York: 
Wiley, 1994. Vol. 2, p. 6-7. 

Mclntyre, W. O. 1931. Memories of Dr. Christopher Co- 
lumbus Graham, Courier-Journal, 27 Dec 1931. 

Nye, R. 13. 1974. Society and culture in America, 1830- 
1860. New York: Harper & Row. 

Peter, R. 1905. History of the medical department of 
Transylvania University. (Filson Club Publications No. 
20) Louisville: John P. Morton, 1905. Kentuckiana Dig- 
ital Library. 

Riebel, R. C. 1954. Louisville panorama: a visual history 
of Louisville. Louisville: Liberty National Bank and 
Trust Company. 

Raflnesque, C. S. 1836. A life of travels and researches in 
North America and south Europe, or, outlines of the 
life, travels and researches of C. S. Raflnesque: con- 



taining his travels in North America and the soutli "I 

Europe, tin- Atlantic Ocean. Mediterranean Sicily, 
Vzores, &c, from 1802 to 1835— with sketches of lus 

scientific and historical researches, &c. Philadelphia: 

Printed for the Author. 
Stickles, A. M. 1935. Tin- ( Christopher ( lolumbus Graham 

dinner. Courier-Journal, I Jim 19 i 
Thieret, J. W. and D. M. Brandenburg. 2001. Rafinesque 

and us. Lloydiana Vol. 6, No. 1:4-9. http://www. 

geocities.coin/kentuekyhist/rafine-tl iieret.html 
VanArsdall. C. A. 1949. A medical history of the Har- 

rodsburg Springs. Bulletin of the History of Medicine, 

Vol, 23, No. 4:387-418. 
Warren, L. 2004. Constantine Samuel Rafinesque: a voice 

in the American wilderness. Lexington: University Press 

of Kentucky. 
Wright, J. D. 1975. Transylvania, tutor to the West. Lex- 
ington: Transylvania University, reprint University Press 

of Kentucky, 1980. 



J K) \cad. Sci. 65(2):154-158 2004. 



NOTES 



Notes on root suckers and leaves of Kentucky Cof- 
feetree (Gymnocladus dioicus; Fabaceae) in Ken- 
tucky. — Root suckers. Although the eastern North Amer- 
ican Kentucky coffeetree (Gymnocladus dioicus; Faba- 
ceae) (KCT) is a part of many floras and guides to wild 
or cultivated woody plants, many of these works do not 
mention that the tree can produce root suckers (root 
shoots), sometimes abundantly, a characteristic not highly 
desirable in a street or lawn tree. Even some of the best- 
known, standard horticultural works (e.g., Bailey [1] and 
Dirr [3]) do not discuss the suckers. Among die exceptions 
to the silence is Anonymous (4): "When the tree is cut 
down the roots send up a large number of suckers." Ehves 
and Henry (5) wrote, "The tree is noted in America for 
its habit of suekering from die roots when it is cut down. 
After a tree is felled the ground around to a distance of 
often 100 feet becomes filled with numerous suckers." 
Suekering, however, is not only a post-aboveground-mor- 
tem phenomenon. Living trees, too, may sucker. That 
these root shoots are a main means of spread of the tree 
was stated by Wilbur (6) and implied by Robertson and 
Lee (7); Steyermark (8) wrote, "The tree occurs some- 
times in small colonies of rather widely separated individ- 
uals, resulting from the habit of the species of sending up 
root suckers at some distance from the parent tree." In 
Canada, where KCT occurs only in extreme southern On- 
tario, it rarely forms seeds but does produce root suckers. 
The trees, "at risk" in Canada, are used as nest sites by 
die increasing population of cormorants in the area. Many 
trees and suckers have been killed by the acidic droppings 
of the large number of birds (9). 

This note reports on suekering of a staminate KCT on 
home grounds in Alexandria, Kentucky, during summers 
2002, 2003, and 2004. 

Suekering began in 2002 while the tree was still very 
much alive; it was 19 years old and had attained a height 
of 6.4 m and a DBH (diameter breast height) of 21 cm. 
Thirteen suckers developed in summer 2002, some as 
much as 6.8 m away from the parent plant. In early sum- 
mer 2003 the tree was cut down, but suekering continued 
and accelerated. Thirty-five additional suckers had ap- 
peared by leaf fall 2003. The rate of suekering was even 
more impressive in 2004. By the time of this writing (16 
Sep 2004) total production of suckers during die 3-year 
period was 220. They had indeed become a pest — perhaps 
even a plague — in die home garden. 

Over the 3 years, most suckers were soon removed; 
eradication continues. Growth of die suckers was rapid. 
One, appearing in 2002, was left for 2 years; in 2004 it 
was taken down when it was 2.4 m tall, unbranched, and 
2.5 cm in stem diameter. 

Total production of suckers from the Alexandrian tree 
through mid-September 2004 was equivalent to ca. 7300 
per acre, a datum that will change as more suckers appear. 
Although this may seem impressive, other trees can pro- 
duce suckers at a much greater rate, e.g., trembling aspen 



(Populus tremuloides), up to ca. .50.0(H) sinkers per acre 

(2). 

Such abundant production >>l KCT suckers occurs else- 
where, too, as around a healthy staminate tree in a home 
yard in Middlctown, Ohio; if die suckers there had not 
been removed, the yard would have been a "coffeetree 
thicket" (David M. Brandenburg pers. coiiiin. 2003). 
Suekering is not confined to staminate trees: a living pis- 
tillate tree in Boone County, Kentucky, produces them 
(Richard Feist pers. comm. 2004 1. 

KCT has been known as a wild-growing plant and as a 
cultivated tree for at least 250 years. Why, then, is the 
suekering habit so often not noted in literature and by- 
some individuals who work with trees? Are only certain 
KCT genotypes prone to suekering? Under what condi- 
tions does KCT suekering occur? Is it a trait expressed 
only after a concatenation of certain environmental con- 
ditions? Does die removal of suckers within a day or two 
of their appearance contribute somehow to their contin- 
ued production? These are questions yet to be answered. 

In eastern North America other trees, too, produce 
suckers. Well known among these are tree-of-heaven (Ai- 
lanthus altissima), papaw (Asimina triloba), hackberry 
(Celtis occidentalism trembling aspen (Populus tremulo- 
ides), black locust (Robinia pseudoacacia), and sassafras 
(Sassafras albidum). 

Leaves. In common with juvenile leaves of various other 
trees, diose of KCT suckers differ from mature leaves 
(Figure 1). On sucker shoots and seedlings of KCT the 
first one to nine leaves are usually 1-pinnate, 6 to 45 em 
long, and with 3-12 pairs of pinnae. Later growth pro- 
duces an increasing number of pinnately compound pin- 
nae, starting widi often one in a median position on the 
rachis of an otherwise 1-pinnate leaf. On some leaves a 
simple pinna or two may be produced between compound 
pinnae. 

At the tip of primary and secondary rachises of die 
leaves of KCT may be an inconspicuous, soft brisde. 
Those I have seen do not exceed 1 cm, but Halsted (10), 
calling them "tendrils," reported diat diose on die primary 
rachis may reach 2.5 cm. What die bristies represent is 
uncertain, although they may simply be extensions of the 
rachis or "degenerate terminal leaflets" (5) much as can 
be seen in black walnut (Juglans nigra; Juglandaceae). 
Similar brisdes may occur also on leaves of honey-locust 
(Gleditsia triacanthos; Fabaceae), a tree related to KCT. 

Though frequendy described as lacking, die stipules of 
KCT, when present, are represented by caducous, minute 
scales or bristles. Stipels are similar to stipules and, like 
them, are not always present. 

Specimens vouchering diis note are deposited in the 
herbarium of Northern Kentucky University (KNK). 

I thank David M. Brandenburg, The Dawes Arbore- 
tum, Newark, OH, and Richard Feist, Burlington, KY, 
for data. 



154 



Notes 



loo 




Figure 1. Silhouette of selected leaves from a Kentucky coffeetree sucker with nine leaves, showing change in leaf 
morphology from the base to the tip of the sucker. Omitted are leaves 3, 5, and 7. each of which was closely similar 
to the leaf immediately below it. (a) Leaf 1, one-pinnate, (b) Leaf 2, one-pinnate, (c) Leaf 4. one-pinnate, (d) Leaf 6, 
mostly one-pinnate but with a median pinna compound, (e) Leaf 8, with four median pinnae compound. (0 Leaf 9. 
mostly two-pinnate, with all pinnae but die basal two pairs compound, the leaf with essentially the same morphology 
as mature leaves of the species. The vertical bar = 10 cm. 



LITERATURE CITED. (1) Bailey, L. H. 1944. The 
standard cyclopedia of horticulture. The Macmillan Com- 
pany, New York, NY. (2) Bates, E. J. S„ C. R. Blinn, and 
A. A. Aim. 2002. Regenerating quaking aspen, http:// 
www.extension.umn.edu/distribution/naturalresources/ 
DD5637.html. Accessed 28 Aug 2004. (3) Dirr. M. A. 
1998. Manual of woody landscape plants. 5th ed. Stipes 
Publishing, Champaign, IL. (4) Anonymous. 1902. Cof- 
feetree (Gymnocladus dioicus). U.S.D.A. Forest Serv. 
Circ. 91. (5) Elwes, II. J., and A. H. Henry. 1906. The 
trees of Great Britain and Ireland. Vol. 2. Privately pub- 
lished. Edinburgh. (6) Wilbur, R. L. 1963. The legumi- 



nous plants of North Carolina. North Carolina Agric. Exp. 
Sta. Techn. Bull. 151. (7) Robertson, K. R., and Y.-T. Lee. 
1976. The genera of Caesalpinioideae (Leguminosae in 
the southeastern United States. J. Arnold. Arbor. 57:1-53. 
(8) Steyermark, J. A. 1963. Flora ol Missouri. Iowa State 
Univ. Press, Ames, 1A. (9) Environment Canada. 2003. 
Species at risk, http://www.spetiesatrisk.gc.ca/search 
speciesDetails-e.cfm?SpeciesID = 222. Accessed in Vug 
2004.(10) Halsted, B. D. 1902. The "tendrils" of the K, n 
tucky coffee-tree. Torreya 2:5-6. — George F. Buddcll 
II, 8790 Napoleon Zion Station Road, Dry Ridge. k\ 
41035. 



L56 



[ournaJ ol the Kentuck) Vcadem) o) Science 6 



Vegetative Proliferation in Eragrostis minor (Little 
Lovegrass; Poaceae). — Unusual or malformed plant 
parts arc occasional!) seen in man) groups ol plants. 
These distortions, termed tcratological, max occur in veg- 
etative structures, such as leaves or stems, or in repro- 
ductive structures, that is. Rowers and fruits ( 1. 2). Darwin 
(3) discussed morphological deviations in his Origin oj 
Species, calling them "monstrosities." which he thought 
would be injurious or at least not useful, stating that such 
could grade into "varieties" if the condition was inherited 
by subsequent generations. 

The replacement of various parts in the spikelets of 
grasses by vegetative growth has been known at least since 
it was reported in 1620 bv Bauhin (4) in the species now- 
known as Poa bulbosa L., and in 1690 bv Rav (5) in what 
is now known as Festuca vivipara (L.) Sm. Many other 
species of grasses have been reported to exhibit similar 
conditions. In a s\nopsis paper on die subject, Beede (6) 
reported such replacement of parts in about SO different 
grass species, many of which have been given varietal or 
form epithets such as "\i\ipara." "prolifera." or even 
"monstrosa." A fairlv widelv distributed example is Poa 
bulbosa L. (bulbous bluegrass), known by most people 
only from its proliferative form. P. bulbosa ssp. cicipara 
(Koel.) Arcangeli, though a non-proliferative form is 
sometimes seen (7). 

Beede (6) recognized diree hpes of vegetative struc- 
tures in grass inflorescences: proliferation, in which die 
paleas and lemmas are replaced by leaf-like structures; 
phyllody, in which the paleas and lemmas are replaced 
widi such well-developed leaves that thev are differenti- 
ated into sheadis and blades; and true civipary, in which 
a seed germinates precociously on the parent plant to give 
rise to a new individual (8). The terms viviparv and pro- 
liferation have been used almost interchangeably and 
without discrimination in the literature for several hun- 
dred vears, but Arber (9) argued that the term "\i\iparv" 
should be restricted to conditions where seeds germinate 
and grow in situ. 

The causes of vegetative proliferations in grasses are 
variable, and may include one or several of the following 
(6, 10, 11, 12, 13): heritable causes, such as hybridization 
and pokyploidv: malformations (teratology), caused bv me- 
chanical injury, chemical damage, or attacks bv patiiogens 
or pests; and adverse environmental conditions, such as in 
water levels, light levels, high altitude or latitudes, and 
abrupt changes in day length or temperature. 

Vegetative proliferations have been reported for several 
species of die genus Eragrostis (love grasses). Beede (6) 
listed three species of the genus in which die condition is 
known: E. brizoides (L.f.) Nees, E. capensis (Thunb.) 



Trin.. and / mrescens PresI; in addition, proliferations 
reported by Jain 14 in E. angetica (Roxb. Steudel. 
I have recentl) seen several specimens of Eragrostis mi- 
rtoi from Kentucky, Michigan, and Ohio: see Specimens 
Examined with abnormal infloresci nces and since I was 
unable to uncover am literature record ol such a condi- 
tion in this grass species further investigation was war- 
ranted. 

Eragrostis minor Host Little lovegrass; Poaceae; Fig. 
I V IB), also known as Eragrostis poaeoides Beaux, ex 
Roemer 6c J. A. Schultes, is a widely distributed, weedy 
species introduced from Europe. It is found in nearly all 
of the lower 4S states in the United States ( http://plants. 
usda.gov/), often along railroad tracks (15, 16), or road- 
sides and paths (17). It is similar to E. cilianensis (All.) 
Janchen (stink grass; = E. megastachya (Koel.) Link 
from which it differs by ha\ing lemmas 1.5-2 mm long 
2-2. S in E. cilianensis). ha\ing andiers 0.2 mm long (0.5 
in E. cilianensis). and often lacking glands on the keel of 
the lemma (usually present in E. cilianensis > (18, 19). 

The proliferations in spikelets of E. minor (Fig. 1C) fit 
best the definition of "phvllodv" as given bv Beetle (6i. In 
some spikelets, all parts, including glumes, have become 
leaf-like, die smaller appearing as blades, and the larger 
differentiated into sheaths and blades. Some spikelets 
have only a single floret replaced bv a proliferation, while 
other spikelets are completely replaced bv what appears 
to be a plandet. In diese proliferative structures, no sexual 
parts are present even diough remaining florets appear 
normal and contain andiers and/or pistils. It is unknown 
whether the vegetative proliferations in E. minor are able 
to function as propagules. 

Manv plant species along the railroad tracks at the Ken- 
tucky and Ohio sites (see Specimens Examined) showed 
evidence of herbicide treatment. It is possible that this is 
die cause of die unusual morphology of some spikelets 
from these populations, though this remains to be tested. 

Specimens examined. KENTUCKY: Mason County; 
Marysville; weedy in railroad vard. 3 Jul 2001. M. A. Yin- 
cent 9562. J. W. Thieret, it W. M. Vincent (KNK, MU). 
MICHIGAN": St. Joseph Counrv; Three Rivers; weedv 
ground at railroad crossing, 17 Aug 1995, A. W. Cusick 
32692 (MICH, MU). OHIO: Butler County; Oxford; 
weedy along railroad line, 19 Jul 2004, M. A. Vincent et 
al. 12159 (DAY. DOY. ISC. KNK. MO. MICH. MU. 
OSH. US, UTC). 

I am grateful for assistance from the following people 
in tiiis study: Thomas Lammers (OSH), Shane Shaw 
(MU), and John W. Thieret (KNK). 

LITERATURE CITED. (1) Goebel, K. 1900. Organ- 
ography of plants. Clarendon Press. Oxford, England. (2) 



Figure 1. A. Whole plant of Eragrostis minor, showing inflorescence widi mixed normal and proliferative florets 
(Vincent 12159, MU; scale bar = 2 cm). B. Inflorescence showing normal florets (Vincent 12159, MU; scale bar = 1 
cm). C. Portion of an inflorescence showing proliferative florets (Cusick 32692, MU; scale bar = 1 cm). 



Notes 



L57 




15S 



al of the Kentucky Acacli 



I Science 65(2) 



Guedes, M.. and 1'. Dnpuv. 1979. Teratological r i ic >< I i f it ;i - 

tions and the meaning ul (lower parts. Today & Tomor- 
row's Printers & Publishers, New Delhi, India. (3) Oar- 
win, C. 1872. The Origin of species. 6th ed. Carlton 
House, New York, NY. (4) Bauhin. C. 1620. Prodromos 
theatri botanici. P. Iacobi, impensis I. Treudelii, Franco- 
furti ad Moenum. (5) Ray, J. 1690. Synopsis methodica 
stirpium britannicarum. Samuel Smith, London. England. 
(6) Beetle. A. A. 1980. Vivipary, proliferation, and phvl- 
lody in grasses. J. Range Managem. 33:256-261. (7) Cus- 
ick, A. W., and M. A. Vincent. 2002. Poa bulbosa ssp. 
bulbosa (Poaceae) in North America. Michigan Bot. 41: 
19-22. (8) Elmqvist, T, and P. A. Cox. 1996. The evolu- 
tion of vivipary in flowering plants. Oikos 77:3-9. (9) Ar- 
ber, A. 1934. The Gramineae. A study of cereal, bamboo, 
and grass. Macmillan, New York, NY. (10) Filatenko, A. 
A. 1969. Teratological changes of the flowers resulting 
from the remote hybridization in die genus Triticum L. 
Bot. Zhurn. 54:153-155. [In Russian.] (11) Harmer, R. 
1984. Vegetative proliferation and vivipary in Scottish 
grasses. Trans. Bot. Soc. Edinburgh 44:261-268. (12) Lee, 
J. A., and R. Harmer. 1980. Vivipary, a reproductive strat- 



egy in response to environmental stress? Oikos 35:254— 
265 (13) Nielsen, E. 1941. Crass studies. V Observations 

on proliferation. Bot. Gaz. 103:177-181. (14) Jain, S, K. 
1968. Notes on Indian grasses — X: Proliferation in Era- 
grostis P. Beauv. and Bromus L. Bull. Bot. Surv. India 10: 
229-230. (15) Brandes. O. 1993. Eisenbahnanlagen als 
Untersuchungsgegenstand der Geobotanik. Tuexenia 13: 
415-444. (16) Peterson, P. M. 2003. Eragrvstis Wolf. Pag- 
es 65-105, volume 25, Flora of North America Editorial 
Committee (eds). Flora of North America North of Mex- 
ico. Oxford Univ. Press, New York, NY. (17) Northam, F. 
E.. R. R. Old, and R. H. Callahan. 1993. Little lovegrass 
(Eragroatis minor) distribution in Idaho and Washington. 
Weed Technol. 7:771-775. (18) Gleason, H. A., and A. 
Cronquist. 1991 . Manual of vascular plants of Northeast- 
ern United States and adjacent Canada. 2nd ed. New York- 
Botanical Garden, Bronx, NY. (19) Hitchcock, A. S., and 
A. Chase. 1950. Manual of die grasses of the United 
States. 2nd ed. USDA Misc. Publ. 200. United States Gov- 
ernment Printing Office, Washington, DC. — Michael A. 
Vincent, W. S. Turrell Herbarium (MU), Department of 
Botany, Miami University, Oxford, Ohio 45056. 



J. Ky. Acad. Sci. 6S(2):159-162. 2001. 



INDEX TO VOLUME 65 



ABBOTT, J. RICHARD, 94 
ABSTRACTS. 59-63 
Acer, 119 
A. negundo, 135 
A. rubrum, 22 
A. saccharinum, 135 
A. saccharum, 134 
Achyranthes japonica, 97 
Vcipenser fulvescens, 77. S3. 91 
Aconitum unoinatum, 97 
Aegopodium podagraria, 97 
Agave, 48 

Agkistrodon contortris mokasen, 24 
Agricultural Sciences, 59-60 
Akebia quinata, 1 10 
Alismataceae, 47 
Alismatidae, 47 

Allegheny woodrat, distribution of, 
33-38 

habitat use of, 33-38 

in a mixed-mesophytic forest. 33- 
38 
Alopecurus pratensis, 97 
Amaranthaceae, 97 
Ambystoma jeffersonianum, 30 
American beech. 22 
American crow, 21, 23 
American robin, 31 
American toad, 29 
Amphibians. 27, 29 
Amur honeysuckle. 27-32 
ANTONIOUS. GEORGE K, 59, fiO 
Anura, 29 
Apiaceae, 97 
Araceae, 47 
Archaeological excavations. 12-20 

at Owl Cave, 12-20 

Mammoth Cave National Park, 
12-20 
Arecaceae, 47 
Arecidae, 47 
Aristolochiaceae, 98 
ARNOLD, S. BROOK. 33 
Aroids, 47 
Arsenic, in tap water, 62 

from private wells. 62 

in central Appalachia, 62 
Ash, white, 134 
Asimina triloba. 22 
Asteraceae, 59. 97 
Atriplex liortensis, 46 
A. littoralis. 46 
AWARDS 2003. 5.5-58 
Azadiraclitin. movement in soil, 60 



BAKER, MICHAEL D.. 21 
RASKIN. CAROL, 53 
BASKIN, JERRY, 53 

Rasswood. 134 

Baylisascaris procyonis, 33 

BE BE. FRED N!. 61 

Beech, 134 

Berea College Forest, vascular flora 

in, 107-131 
BERTRAM. LONNIE R„ 33 
Beta-actin genes, 104-107 
Bittemut hickory, 134 
Black holes, gravitational tensing of. 

62 
Black oak, 22 
Black rat snake, 29 
BLALOCK, RICHARD. 62 
Blight, chestnut, 33 
Blue jay, 23 

Bluegrass, bulbous, 156 
Bluestem, little. 137 
Bhmtnose darter, 80 
BOATENG, DADDY N„ 59 
Boehmeriopsis pallida, 67 
Bog lemming, southern, 34 
BOOK REVIEW, 54 
Boone Count)- Kentucky, 132 
natural terrestrial vegetation of, 

132-139 
Botrvchium, 46 
Bouteloua curtipundula, 137 
Box turtle, eastern, 29 
Box turtles, 29 
Boxelder, 135 
Brassicaceae, 97 
BREWER, KEVIN S., 33 
Broad-headed skink, 30 
Bromeliaceae, 47 
Bromeliads, 47 
Brown snake, 29 
Brown-headed cowbirds, 21, 23 
BRYANT, WILLIAM S.. 132 
BUDDELL. GEORGE E, 51 
BUDDELL, GEORGE E. 155 
Bufo americanus, 29 
Bufonidae, 29 
Bulbous bluegrass, 156 
Bullfrog, 29 
Burbot, 80 

Cacalia suavoeolens, 97 
Cactaceae, 46 

Calcium, in plasma ol rats. 61-62 
Cambarus cumberlandensis, 78 
C. laevis, 108 
Camelina microcarpa, 97 
Campanulaceae, los 
CAMPBELL, NATALIE J.. 33 
Caprifoliaceae, 27-32 
Capsicum annuum Bell Boy, 59 
Cardamine impariens 97 



Carex, 17 

C. pedunculata, 97 

< \RSTE\S KENNETH C. 12 
Carya, 119 

C. cordiformis, 134 
C ovata, 134 
C. spp., 22 

< iaryophyllaceae, loo 
Caryophyllidae 16 

Castanea pumila var. pumila, 104 
Catonotus, SI 
Cat-tails, 47 
Caudata, 29 
Cavefish, spring so 
Celastraceae, 1 10 
Celosia argentea, 46 
Centra] newt. 29 
Centrarchidae, 104-107 
Chenopodiaceae, 46 
Chenopodiaceae, 97 
Chenopodium ambrosioides, 46 
C. botrys, 46 
C. pumilio, 97 
C. spp., 46 
Chestnut blight. 33 
Chestnut oak. 22. 1 19 
Christopher Columbus Graham. 

149-153 
Chrvsosplenium americanum, 98 
CICERELLO, RONALD R., 76 
CLARK. AMY M., 33 
Cla\tonia caroliniana, 46 
CLEMONS, CHAD M.. 33 
CLEMONS, JOE E.. JR.. 33 
Clinostomus elongatus, 78 
C. funduloides, 7s 
COE, STEVE, 62 
Colubridae, 29 
Colubrids. 29 
Commelinaceae. 47 
Commelinidae, 47 
COMPTON, MICHAEL C, 76 

< (AIPTON, R. N., 5 
COMPTON, STEPHEN, 62 
COOPER, ANN-SIMONE, los 
COOPER, NIGEL C. F 57 
COOPER, ROBIN L. los 
Copper, in plasma of rats. 61-62 
Copperhead. 24 

Comtis florida, 22 

Corvus brachyrhynchos, 21. 23 

Cottonwood, 135 

Cowbell Reservoir, 1 17 

< Irangon crangon, 1 11 
Crataegus coccinea, Mil 
Crayfish, 7s ins 
Crow, American. 21 
Cryphonectria parasitica I I 
Cucurbita, 12. 17 
Cyanocitta cristata, 23 

( yperaceae, 17. 97. loo 



159 



lfi() 



Journal oi the Kentucky Acaderm of Science 65(2) 



Cyperus, 47 
Cspraceae, 98 
Cyprinella glactura, 78, 88 
Cypripedium calceolus var. parviflo- 
rum, 98 

C. parviflorum, 98 

Dace, mountain redbelly, 79 

redside, 78 

rosyside, 78 
Darevskia valentini, 1 
Darter, bluntnose, 80 

duskytail, 82 

fringed, 81 

johnny, 90, 91 
Deer, white-tailed, 15-16 
Dendroica discolor, 24 

D. virens, 24 
DERTING, TERRY, 62 
Desmognathus fuscus, 29-30 
DICK. D. KYLE, 33 
Dioscorea quatemata, 48 

D. villosa, 48 
d-iron complex, 
Disporum maculatum, 98 
Distinguished college/university sci- 
entist award, 57-58 
DURTSCHE, RICHARD D., 27 
Dusky salamander, 29 
Duskvtail darter, 82 
DUVALL, JAMES, 140 
Dysphania, 46 

D. anthelmitica, 46 

Eastern box turtle, 29 
Eastern garter snake, 29 
Eastern redcedar, 137 
Ecoregions map, Kentucky's Level 

IV, 60 
EISENHOUR, DAVID J., 76 
Elaphe obsolete, 29 
Eleocharis, 47 
Empidonax virescens, 24 
Emydidae, 29 
Epigean cravfishes. growth of, 108- 

115 
Equisetophyta, 116, 120 
Eragrostis brizoides, 156 

E. capensis, 156 
E. cilianensis, 156 
E. megastachva, 156 

E. minor, vegetative proliferation in, 

156-158 
E. poaeoides, 156 
E. virescens, 156 
Eriophorum virginicum, 98 
Esox masquinongy, 77 
Etheostoma chlorosoma, 80 
E. crossopterum, 90, 91 
E. nigrum, 81 
E. olivaceum, 81 
E. percnurum, 82 
E. squamiceps, 81 
Eumeces fasciatus, 3 



E. laticeps, 3, 30 
Euonymus alata, L10 
Eurasian milfoi, 27 
Eurecea cirrigera, 29-30 
European wall lizard. 1—4 

Fabaceae, 104, 154 
Fagaceae, 46, 104 
Fagus, 119 

F. grandifolia, 134 

Fast LDA calculation, modeling ni- 
tride crystals, 85-93 

Fatoua aspera, 67 

F. japonica, 67 

F. \iIlosa, 67-75 

Faxonius propinquus, 110 

FERNANDO, SHAMANTHI, 62 

FERNER, JOHN YV., 1 

Festuca \ivipara, 156 

Fishes, Kentucky, distributional re- 
cords of, 76-84 

FLEMING, CHRIS A., 116 

Floerkea proserpinacoides, 98 

Flora of North America, comments 
on, 39^0 

Flowering dogwood, 22 

Food choices, 61 

Forbesichthys agassizii, 80, 82 

Forest songbirds, nesting success of, 
21-26 
in mixed mesophvtic forests, 21- 

26 
in Kentucky, 21—26 

Fraxinus, 119 

F. americana, 134 

FRAZIER, DONALD T.. 56 

Fringed darter, 81 

Frog, green, 29 

Frogs, true, 29 

Frogs and toads, 29 

GALBRAITH, SHANNON L., 132 

Garter snake, eastern, 29 

GELIS, RUDY A., 94 

Gentiana fiavida, 98 

Gentianaceae, 98 

Geography, 60 

Geraniaceae, 98 

Geranium dissectum, 98 

Geum laciniatum, 104 

Grama, side-oats, 137 

Grass, Indian, 137 

stink, 156 
Gravitational lensing, of black holes, 

62 
Green frog, 29 
Guidelines for Contributors to the 

Journal, 64—65 
Gymnocladus dioicus, 154-155 
Gypsy modis, 33 

Hamamelidae, 46 
HAWKINS, LISA, 60 
Health Sciences, 60-62 
HELD, MICHAEL E., 132 



Heracleum lanatum, 104 

II maximum, Mil 

Herbicide movement, in soil water, 

59 
Herpetofauna biodiversity, 27-32 
I lexastylis heterophylla, 98 
II. virginica, 98 
Hickories. 22-23 
Hickory, bittemut, 134 

shagbark, 134 
IIORRALL, AUDREY D., 33 
Hybognathus ha\i, 79 
Hydrocharitaceae, 100 
Hylocichlia mustelina. 31 

Iclithyomyzon ammoecetes. 77 

I. bdellium, 77 

I. fossor, 77 

I. unicuspis, 77, 81 

Indian grass, 137 

Italian wall lizard, 1^1 

Jackson County, vascular flora in, 

107-131 
Jefferson salamander, 30 
Johnny darter, 81 
JOHNSON, DIANE, 55 
JONES, NATALIE J.. 33 
JORDAN, CLARENCE, 59 
Juglans, 17 
Juncaceae, 47 
Juncus, 47 
Juniperus \irginiana, 137 

Kalmia laufolia, 23 
Kentucky coffee tree, 154—155 
Kentucky fishes, distributional rec- 
ords of, 76-84 
Kentucky- vascular plants, 94-103 
Kerria japonica, 110 
KOCHHAR, TEJINDER S., 59 
KORNMAN, LEWIS E., 76 
KRUPA, JAMES J., 33 
Kudzu, 27 

Lacertidae, 1—4 
LACKI, MICHAEL J., 21 
Lake sturgeon, 77 
Lamprey, Ohio, 77 

silver, 77 
Lardizabalaceae, 110 
LAUDERMILK, ELLIS L., 76 
La\th\Tus hirsutus, 104 
Lemming, southern bog, 34 
Lemna valdiviana, 47 
Lepomis cyanellus, 104-107 
L. macrochirus, 104-107 
Ligustrum obtusifolium, 110 
Liliaceae, 48, 98 
Liliopsida, 120 
Limnanthaceae, 98 
Linaceae, 108 
Lindera benzoin, 22 
Linum usitatissimum, 108 
Liparis loeselii, 10S 



Index to Volume fi5 



L61 



Liriodendron, 1 19 
L. tulipifera, 22, 134 
I., tulipifera, 134 
l-iron complex, 
Little bluestem, 137 
Little lovegrass, 156-158 
LLOYD, CHRISTOPHER M., 33 
Lobelia nuttallii, 108 
Lonicera niaackii, 27—32 
Lota lota, 89, 91 
Lovegrass, little, 156-158 
Lower Silver Creek Reservoir, 117 
Ludwigia hirtella, 96 
Lungless salamanders, 29 
Lvciuni barbarum, 102 
Lycopersicon esculentum "Moun- 
tain Spring," 59 
L. hirsutnm, 59 

f. glabratum, 59, 60 

f. hirsutum, 59, 60 
L. pennellii, 59, 60 
L. pimpinellilolium, 59, 60 
Lycopodiaceae, 96 
Lycopodiella appressa, 96 
LyeopodiopliN'ta, 116, 120 
Lycopodium appressum, 96 
Lymantria dispar, 33 
Lysimachia vulgaris, 10S 
Lvtlmnn salicaria, 27 

Madison County, vascular flora in, 

107-131 
Madtom, slender, 79 
Magnoliophyta, 116, 120 
Magnoliopsida, 120 
Magnolophvta. 46, 47 
MAHURIN, S. M., 5 
Maianthemum, 48 
Malvaceae, 100 
Manfreda, 48 
Maple, silver, 135 

sugar, 134 
MARLETTE, MARTHA A., 61 
MATHIS, CALEB, 62 
McCLURE, S. B„ 5 
McEVOY, NICHOLAS L„ 27 
Meadow vole, 34 
MEIJER, WILLEM, 52-53 
Microtus pennsylvanicus, 34 
Mite, two-spotted spider, 60 
Mniotilta varia, 24 
Mognoliidae, 46 
Molothrus ater, 21 
Monolepis nuttalliana, 46 
Moraceae, 67 
Mows alba, 102 
Mountain redbellv dace, 79 
Mountain-laurel, 23 
Mulberry Weed, 67-75 
MUNSIF, SIDDHARTH, 62 
Muskellunge, 77 
MUTISYA. SAMUEL M„ 60 
\IYKA, JENNIFER LEICH, 63 
Myosoton squaticum, 100 



Mvrioplivlluin spicatum, 27 

Neotoma magister, distribution of, 

33-38 
habitat use of, 3.3-38 
in a mixed-mesnphvtic forest, 33 
38 

Nesting success, of forest songbirds, 
21-26 

Newt, central, 29 

Newts, 29 

NCYVANG, HERMINE, 61 

Nitride crystals, fast LDA calcula- 
tion to model, 8.5-93 

Nocomis effusus, 78 

Northern red oak, 22, 134 

NOTE, 51 

NOTES, 154-158 

Notopthalamus viridescens, 29-30 

Notropis telescopus, 78 

N. maculatus, 79 

Notuws exilis, 79 

Oak, chestnut, 22, 1 19 
northern red, 134 
white, 134 

Oak-hickory forest, 22 

Oenothera linifolia, 108 

Ohio lamprev, 77 

OKONNY, ESUGHANI. 61 

Oleaceae, 110 

Onagraceae, 96, 108 

Ophioglossaceae, 46 

Orchidaceae, 48, 98, 100, 108 

Orconectes australis australis, 112 

O. australis packardi, 108-115 

O. cristavarius, 108-115 

O. inermis inermis, 112 

O. propinquus, 110 

OTIENO, TOM, 63 

Outstanding Academy service award, 
56-57 

Outstanding college/university sci- 
ence teacher award, 55 

Outstanding secondary school sci- 
ence teacher award, 55—56 

Owsley Fork Reservoir, 118 

Palms, 47 

PANEMANGALORE, MYNA. 61 
Papaver dubium, 108 
Papaveraceae, 46, 108 
Parity-violating energy difference. 

5-11 
PATTERSON, MATTHEW A., 59, 

60 
Pawpaw, 22 
PCR-based Fl Hybrid Screen, 104- 

107 
Pepper sweet, 59 
Peromyscus leucopus, 62-63 
Pest control, phytochemicals for, 59 
PEYTON, DAVID K.. 104 
Phoxinus oreas, 79, 82 
Physics and Astronomy, 62 



Physiology and Biochemistry, 62-63 
Phytochemicals, for pest control. 59 
Pinophyta, 1 16, 120 

r s, U9 

P. echinata, 23 
P. virginiana, 23 

Pinus-Liriodendron-Quercus com- 
plex. 110 
Plant-based laboratory project. 63 
Platanthera integrilabia, 10S 
Plethodon cinereus, 29-30 
P. glutinosus, 27, 29-3] 
P. richmondi, 29-30 
Plethodontidae, 29 
Poa bulbosa, 100, 156 

ssp. vivipara, 156 
Poaceae. 47. 97 
Podarcis muralis, 1—4 
P. muralis muralis, 1 
P. pityusensis vedrae, 2 
P. sieula, 1^1 
Polygonaceae, 104 
Polygonum densiflowm, 103. 113 
Polypodiophvta, 116, 120 
Poplar, tulip! 134 
Populus deltoides. 135 
Potamogeton, 47 
Potomogetonaceae, 47 
PRATER, CALLIE A., 33 
Primulaceae, 108 
Procambarus clarldi, 113 
Procyon lotor, 33 
Pueraria montana, 27 
Purple loosestrife, 27 
Pyrethrins, on pepper fruits, 59 

on tomato fruits, 59 

Quercus, 119 

Q. alba, 22, 134 
Q. coccinea. 22 
Q. prinus, 22 
Q. wbra, 22. 134 
Q. velutina, 22 

Rabbits, 15 

Raccoon, 33 

Raccoon roundworm, 33 

Raccoons, 15 

Rana catesbeiana, 29-30 

R. clamitans, 27, 29, 31 

Ranidae, 29 

Ranunculaceae, 46, 96. 97. LOO 

Ranunculus ficaria, 100 

R. parviflows, 96 

R. pusillus, 96 

R. sceleratus, 96 

Rat snake, black. 29 

RAUBENHE1MER. DIANNE, 63 

Ravine salamander. 29 

Red Lick Reservoir, lis 

Red maple, 22 

Red oak. northern, 134 

Redbacked salamander, 29 

Redbellv dace, mountain, 79 



162 



il of the Kentucky Academy oi Science 65(2) 



Redcedar, eastern, 137 
Redside dace, 78 
Reptilia, I A, 29 
Rhamnaceae, 1(1(1 
Rhamnus firangula, Km 
Rhododendron, 23 
Rhododendron maximum, 23 
Rhynochospora, 47 
RIVERS, RORERT C, 61 
Robin, American, 31 
Rosaceae, 104, 110 
Rosyside dace, 78 
Roundworm, raccoon, 33 
Rubiaceae, 100 

Salamander, dusky, 29 

Jefferson, 30 

ravine, 29 

redbacked, 29 

slimy, 29 

southern two-lined, 29 
Salamaders, 29 

lungless, 29 
Salamandridae, 29 
Salicaceae, 51 
Salicornia depressa, 46 
S. europes, 46 
Salix exigua, 51 
Salsola collina, 46 
Sandbar willow, 51 
Saxifragaceae, 98 

Scaphirhynchus platorynchus, 78, 91 
Scarlet oak, 22, 119 
Sceloporus undulatus, 3 
Schizachyrium scoparium, 137 
Schoenoplectus, 47 
S. tabemaemontani, 47 
School lunch, nutritional benefit, 

61-62 
School lunch plate waste, 61 
Science Education, 63 
Science instruction, enhancing in 

middle schools, 63 
Scirpus, 47 
S. fluviarilis, 100 
S. validus, 47 
Scrophulariaeeae, 96 
Seiurus aurocapillus, 24 
Serpentes, 29 
Setophaga ruticilla, 24 
Sewage sludge, in land farming, 60 
Shagbark hickory, 134 
SHAW, CHARLES P., 33 
Sherardia arvensis, 100 
SHIRER, JOHN G., 62 
Shiner, taillight, 79 

whitetail, 78 
Shortleaf pine, 23 
Shovelnose sturgeon, 78 
Shrimp, 114 
Sida hermaphrodita, 100 



Side-oats grama, 137 
Silcnr ovata, 100 
Silver lampre) 77 
Silver maple, 135 
Skink, broad-headed, 30 
Slender madtom, 79 
Slimy salamander, 29 
Smilacina, 48 
Snake, black rat, 29 

brown, 29 

eastern garter, 29 
Snakes, 27, 29 
SNYDER, JOHN C, 60 
Soil water, herbicide movement in, 

59 
Solanacedae, 102 
Solonaeeae, 59 
Sorgastrum nutans, 137 
SOTO, MARGARET M„ 63 
Southern bog lemming, 34 
Southern two-lined salamander, 29 
Spicebush, 22 

Spider mite, two-spotted, 60 
Spinacia oleracea, 46 
Spiranthes lucida, 100 
Spring cavefish, 80 
Squamata, 29 
Squash, 17 
Squirrels, 15 
Stellaria aquatica, 100 
Stink grass, 156 
Storaria dekai, 29 
Stuekenia, 47 
S. filiformis, 47 
S. peetinatus, 47 
Sturgeon, lake, 77 

shovelnose, 78 
Stygobitic crayfishes, growth of, 

108-115 
Sugar maple, 134 
Sunfishes, 104-107 
SURMONT, ALBERT, JR., 76 
Sweet pepper, 59 
Synaptomys cooperi, 34 

Taillight shiner, 79 
Tanacetum einerarilolium, 59 
TEMPLETON, SUSAN B., 60, 61 
Terrapene Carolina, 27, 29-30 
Terrestrial vegetation, of Boone 

County, Kentucky, 132-139 
Testudines, 29 
Tetranychus urticae, 60 
Thamnophis sirtalis, 29-30 
THIERET, JOHN W„ 51 
THOMPSON, MATTHEW, 63 
THOMPSON, RALPH L., 94, 116 
Thrush, wood, 31 
Tilia americana, 134 
Toads, 29 
Tomato, 59 



Tradescantia zebrina, 17 
True frogs, 29 
Tulip poplar, 134 
Turdus migratorius, 31 
Turtle, eastern box, 29 
Turtles. 27. 29 
Turtles. 29 

box. 29 

water, 29 
Two-spotted spider mite, 60 
Typhaceae. 47 

Upper Silver (.'reek Reservoir, 117 
Urtiea japonica, 67 

VALENTINE, ANGELA M., 33 

Vallisneria americana, 100 

Vascular flora, in Jackson County, 
107-131 
in Madison County, 107-131 
in the Berea College Forest, 107- 
131 

Vascular plants of Kentucky. 94-103 

Veronica polita, 96 

VINCENT, MICHAEL A., 67 

Vireo olivaceus, 24 

V. solitarius, 24 

Virginia pine, 23 

VIRK, MANINDER, 62 

Vole, meadow, 34 

Walnut, charred, 17 

Wandering jew, 47 

Water turtles, 29 

White ash, 134 

White oak, 22, 119, 134 

WHITE, BRENT C, 55 

White-footed mice, health of, 62 

anthropogenic disturbance on, 
62-63 
Whitetail shiner, 78 
WHITSON, MAGGIE, 54 
Willow, sandbar, 51 
Wilsonia citrina, 24 
Wood thrush, 31 

Woodrat, Allegheny, distribution of, 
33-38 

liabitat use of, 33-38 

in a mixed-mesophytjc forest, 33- 
38 
WORKMAN, JEFFREY W, 33 

YACEK, HENRY F JR., 21 

Yellow-poplar, 22 
Y'ODER, G, 94 

Zebrina pendula, 47 
Zinc, in plasma of rats, 61-62 
Zingiberidae, 47 

Zoology laboratory activities, in fresh- 
man biology majors course, 63 
ZOURARAKIS, DEMETRIO P.. 60 



Guidelines for Contributors lo the Journal 



1. GENERAL 



Mil he con- 



A. Original research/review papers in science wi 

sidered for publication in JKAS; at least the first author 
must be a member of the Academy. Announcements, 
news, and notes will be included as received 

13. Acceptance ol papers for publication in [KAS depends 
on merit as evaluated by each ol two or more review- 
ers. 

C. Papers (in triplicate) may be submitted at any time to 
the editor. 

John W. Thieret 

Department of Biological Sciences 

Northern Kentucky University 

Highland Heights. KY 41099 

Phone: (859) 572-6390; Fax: (859) 635-3490 

E-mail: thieretj@exchange.nku.edu 

List in the cover letter your telephone/FAX numbers, 
your E-mail address, and the names, addresses, and 
telephone numbers of two persons who are potential 
reviewers. 

D. Format/style of papers must conform to these guide- 
lines and also to practices in recent issues of JKAS. 
which are, in effect, a style manual. 

E. Papers should be submitted in hard copy. Do not sta- 
ple pages together. 

F. Indent the first line of each paragraph (but not the 
first line of entries in the Literature Cited). 

2. FORMAT 

A. Papers should be in 12-point type on white paper 8.5 
X 11 inches, with margins at least 1 inch all around. 
Double-space throughout the paper (i.e., one full line 
of space between each two lines of text, literature cit- 
ed, or tabular data). Do not justify right margins. 

B. Except for scientific names of genera and of infrage- 
neric taxa. which should be tvped in italics, die same 
type (roman) should be used throughout (i.e., one type 
size only; bold only for paper title). 

C. Sequence of sections in papers should, where appro- 
priate, be as follows: title of paper, name/address of 
author(s), abstract, bodv of paper, footnotes, table cap- 
tions, figure captions (all the preceding on consecu- 
tively numbered pages), tables, and figures. 

D. The running head (top right) should give nanie(s) of 
audior(s), a short version of paper title, and page num- 
ber of total. 

E. The first page should include the running head and. 
centered near the top of the sheet, the paper's title 
and the name and address of author(s). These should 
be followed immediately by the abstract. (The first 
page should look as much as possible like the first page 
of articles in JKAS.) 

F. The abstract, not to exceed 200 words, should be con- 
cise, descriptive, and complete in itsell without refer- 
ence to the paper. 



(;. The body ol the paper should, where appropriate in 
elude the following sections: Introduction Materials 
and Methods, Results, Discussion, Summary, Acknowl- 
edgments, and Literature Cited. 

I I. No mure than three levels of headings should be used: 
level 1. in capitals, centered; level -. in capitals/low- 
ercase, flush left; level ■'!. in italics, a paragraph indenl 
with initial capital onlv i except proper nouns and ad- 
jectives), and followed b) a period, the text then start- 
ing alter one blank space. 

I Personal communications (avoid il possible should be 
indicated in the text as follows: (name, affiliation, pers. 
eomni.. elate), e.g.. (O.T. Mark. Wainw right College 
pers. comm.. 5 Jim 1995). 

3. STYLE 

A. In text, spell out one-digit numbers unless they arc- 
used with units of measure (four oranges, 4 cm) and 
use numerals for larger numbers; do not begin am 
sentence with a numeral. 

B. Use no footnotes except those for title page and tables. 
Footnotes, identified by consecutive superscript num- 
bers, should be entered on a separate sheet. 

C. Measurements should be in metric and Celsius units 
Define lesser-known symbols and give the meaning of 
acronyms at first use. Express time of das in the 24- 
hour system. Dates should be written day, month (ab- 
breviated to three letters), year without internal punc- 
tuation. Units with multiple components should ha\e 
individual components separated bv a virgule (e.g., g/ 
m 2 or g/m 2 /yr). 

D. Names of authors of binomials may be included but 
onlv at the first mention of die binomial. Cultivar 
names are not italicized but are enclosed in single 
quotes. 

E. Useful guides for contributors to JKAS are die follow- 
ing: Scientific style and format: the CBE manual for 
authors editors, and publishers, 6th ed., Cambridge 
University Press, 1994: The Chicago manual of style, 
14th ed.. University of Chicago Press, 1993; The ACS 
style guide, American Chemical Society, Washington, 
DC, 1986; and All' sli/le manual. American Institute 
of Physics, New York, 1990. 

4. IN-TEXT CITATION OF LITERATURE 

A. Cite publications in the text b\ author(s) and date — 
e.g., (Readley 1994); multiple citations should l>c in 
alphabetical order and separated by semi-colons — e.g., 
(Ashley 1987; Brown 1994; Foster 1975': multiple ci- 
tations of works by one author(s) should be in chro- 
nological order — e.g.. (|oucs 197S. 1KIS3 1 : publications 
by one author(s) in the same vear should be distin- 
guished In a. b, c. etc.— e.g.. (Smith 1994a. 1994b . 
For in-text references to works with one or two authors 
use names of both authors — e.g., [ones and Williams 
1991); for works with three or more authors use name 



163 



US4 



il the (Centuck) A.cadem\ <>l Science 65 J 



of the first author followed In et al. — e.g., (Lee el tl 
19S5). 
B. Do not include an) reference unless it lias been pub- 
lished or accepted for publication ("in press" sei I" 
low). 

5. LITERATURE CITED 

A. List all authors of each entry. Do not abbreviate jour- 
nal titles; abbreviations for these will be supplied by 
the editor. 

B. The first line of each reference should be txped (lush 
left; the remaining lines should be indented. 

C. Examples of common types of references are given 
below. 

JOURNAL ARTICLE 

Lacki. M.J. 1994. Metal concentrations in guano from a 
gray bat summer roost. Transactions of the Kentucky 
Academy of Science 55:124-126. 

BOOK 

Ware, M., and R.VV. Tare. 1991. Plains life and love. Pi- 
oneer Press, Crete, WY. 

PART OF A BOOK 

Kohn. J.R. 1993. Pinaceae. Pages 32-50 in J.F. Nadel 
(ed). Flora of the Black Mountains. University of 
Northwestern South Dakota Press, Utopia, SD. 

WORK IN PRESS 

Groves, S.J., I.V. Woodland, and G.H. Tobosa. n.d. De- 
serts of Trans-Pecos Texas. 2nd ed. Ocotillo Press, 
Yucca City, TX. 

6. ILLUSTRATIONS 

FIGURES (LINE DRAWINGS, MAPS, GRAPHS, PHO- 
TOGRAPHS) 

Figures must be camera-ready, glossy, black-and-white 
prints of high quality or laser prints of presentation qual- 
ity. These should be designed to use available space ef- 
fectively: a full page or part of one, or a full column or 
part of one. They should be mounted on heavy white 
board and covered with a protective sheet of paper; pho- 
tographs to be grouped as a plate should have no space 
between them. Dimensions of plates must observe page 
proportions of the journal. Each illustration in a plate may 
be numbered as a separate figure or the entire plate may 
be treated as one figure. Include scale bars where appro- 



priate, l ottering should be large enough i" be legible after 
reduction; us,' lowercase letters for sections ol a figure. 
Figure captions should be self-explanator) without refer- 
ence to the texl and should be entered '>u a page separate 
from the text. Number figures in Arabic numerals. Statis- 
tics presented in figures should be explained in die caption 
(e.g., means are presented ± SE, n = 71. 

TABLES 

Each table and its caption must be double-spaced, num- 
bered in Arabic numerals, and set on a sheet separate 
from the text. The caption should begin with a title relat- 
ing the table to the paper of which it is a part; it should 
be informative of the table's contents. Statistics presented 
in the table should be explained in the caption (e.g., 
means are presented ± SE, n = 7). Table should be sub- 
mitted in hard copy only; they need not be included on a 
disk. 

7. ETHICAL TREATMENT OF ANIMALS AS RE- 
SEARCH SUBJECTS 

If vertebrate or invertebrate animals are involved in a re- 
search project, the author(s) should follow those guide- 
lines for ethical treatment of animals appropriate for the 
subjects, e.g., for mammals or for amphibians and reptiles. 
Papers submitted to JKAS will be rejected if their content 
\iolates either die letter or the spirit of the guidelines. 

8. PROOFS 

Authors are responsible for correcting proofs. Alterations 
on proofs are expensive; costs will be assessed to authors. 
Proofs must be returned to the editor within 3 days after 
the author receives diem; delay in return may result in 
delay of publication. 

9. REPRINTS 

Forms for ordering reprints will be sent to the autiior 
when die proofs are sent. They are to be returned direcdy 
to Allen Press, not to the editor. 

10. PAGE CHARGES 

Pages charges are assessed to audiors of papers published 
in Journal of the Kentucky Academy of Science. 

11. ABSTRACTS FOR ANNUAL MEETINGS 

Instructions on style of abstract preparation for papers 
presented at annual meetings may be obtained from the 
editor. Copies will be available also at each annual meet- 
ing of die Academy. 



NEWS 

Kentucky Heritage Land Conservation Fund 

The mission of the Kentucky Heritage Land Conservation Fund (KHLCF) is to 
award funding to purchase and preserve selected natural areas in the Commonwealth; 
to protect rare and endangered species and migratory birds; to save threatened areas 
of natural importance; and to provide natural areas for public use, outdoor recreation, 
and education. 

Established by the 1994 Kentucky Legislature, KHLCF is administered by a 
12-member board appointed by the governor. The board can award grants to acquire 
and protect areas of natural significance to local governments, state colleges/univer- 
sities, and specified state agencies. Special consideration will be given to the funding 
of agencies working together to meet the listed goals. All acquisition applications, 
along with comprehensive management plans, must be submitted to and approved by 
the board. 

The year 2003 was another eventful year for the KHLCF board. During 2003 it 
received and reviewed a large number of applications and approved 14 projects in 13 
counties. In 2003 local government projects were approved in Calloway, Clark. 
Green, Harrison, Livingston, Logan, and Oldham counties; state agency projects 
were approved in Franklin, Garrard, Hardin, Harlan, Larue, and Letcher counties. 
The board also approved the Pine Mountain Trail State Park and provided initial 
acquisition funds. The trail will traverse Bell, Harlan, Letcher, and Pike counties. 

Since the first awards were made in October 1995 the board has approved 116 
projects in 56 Kentucky counties. Almost 20,000 acres have been purchased. 

The fund is supported by the state portion of the unmined minerals tax, 
environmental fines, the $10 additional fee to purchase a Kentucky nature license 
plate, and interest on the fund's assets. 

For more information, contact the Department of Natural Resources, 
Commissioner's Office, 663 Teton Trail, Frankfort, KY 40601. The phone number 
is (502) 564-2184; the e-mail address is www.heritageland.ky.gov. 



AMNH LIBRARY 



00167231 



Journal Ql 

of Science.. 
American Museum of Natural 
History 
CONTENTS Received on: 02-08-05 



ARTICLES 

Spread of Fatoua villosa (Mulberry Weed; Moraceae) in North America. 
Michael A. Vincent 67 

Distributional Records of Selected Kentucky Fishes. Michael C. Compton, 
David J. Eisenhour, Ronald R. Cicerello, Lewis E. Kornman, Albert 
Surmont Jr., and Ellis L. Laudermilk 76 

Developing a Fast LDA Calculation to Model Group HI Nitride Crystals. 

G. Vbder 85 

Noteworthy Vascular Plants From Kentucky: A State Record, Range 
Extensions and Various Species of Interest. J. Richard Abbott, Ralph L. 
Thompson, and Rudy A. Gelis 94 

A PCR-based Fj Hybrid Screen using the Beta-actin Genes from the 
Sunfishes Lepomis cyanellus and L. macrochirus (Centrarchidae) 
David K. Peyton 104 

Growth of Stygobitic (Orconectes australis packardt) and Epigean 
(Orconectes cristavarius) Crayfishes Maintained in Laboratory Conditions. 
Ann-Simone Cooper and Robin L. Cooper 108 

Vascular Flora of Five Reservoirs in the Berea College Forest, Madison 
and Jackson Counties, Kentucky. Ralph L. Thompson and Chris A. 
Fleming 116 

Natural Terrestrial Vegetation of Boone County, Kentucky: Classification, 
Ordination, and Description. William S. Bryant, Shannon L. Galbraith, and 
Michael E. Held 132 

Christopher Columbus Graham: Kentucky Man of Science 140 

NOTES 

Notes on Root Suckers and Leaves of Kentucky Coffeetree (Gymnocladus 
dioicus; Fabaceae) in Kentucky. George F. Buddell II 154 

Vegetative Proliferation in Eragrostis minor (Little Lovegrass; Poaceae). 
Michael A. Vincent 156 

News Inside back cover 

List of Recent Reviewers 75 

Index to Volume 65 158 



CONTENTS 



AMNH LIBRARY 



100 



67231 



Journal oj 

of Science.. 

American Museum of Natural 

History 

Received on: 02-08-05 



ARTICLES 

Spread of Fatoua villosa (Mulberry Weed; Moraceae) in North America. 
Michael A. Vincent 67 

Distributional Records of Selected Kentucky Fishes. Michael C. Compton, 
David J. Eisenhoui; Ronald R. Cicerello, Lewis E, Kornman, Albert 
Surmont Jr., and Ellis L. Laudermilk 76 

Developing a Fast LDA Calculation to Model Group HI Nitride Crystals. 

G. Vbder 85 

Noteworthy Vascular Plants From Kentucky: A State Record, Range 
Extensions and Various Species of Interest. J. Richard Abbott, Ralph L. 
Thompson, and Rudy A. Gelis 94 

A PCR-based Fj Hybrid Screen using the Beta-actin Genes from the 
Sunfishes Lepomis cyanellus and L. macrochirus (Centrarchidae) 
David K. Peyton 104 

Growth of Stygobitic (Orconectes australis packardf) and Epigean 
(Orconectes cristavarius) Crayfishes Maintained in Laboratory Conditions. 
Ann-Simone Cooper and Robin L. Cooper 108 

Vascular Flora of Five Reservoirs in the Berea College Forest, Madison 
and Jackson Counties, Kentucky. Ralph L. Thompson and Chris A. 
Fleming 116 

Natural Terrestrial Vegetation of Boone County, Kentucky: Classification, 
Ordination, and Description. William S. Bryant, Shannon L. Galbraith, and 
Michael E. Held 132 

Christopher Columbus Graham: Kentucky Man of Science 140 

NOTES 

Notes on Root Suckers and Leaves of Kentucky Coffeetree (Gymnocladus 
dioicus; Fabaceae) in Kentucky. George F. Buddell II 154 

Vegetative Proliferation in Eragrostis minor (Little Lovegrass; Poaceae). 
Michael A. Vincent 156 

News Inside back cover 

List of Recent Reviewers 75 

Index to Volume 65 158 






I 



H 











I 

I I v . 




■ 



■ 



I